Agonopterix doronicella

Wocke, 1850 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records15

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Agonopterix doronicella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 7 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agonopterix doronicella is a moth of the family Depressariidae. It is found in France, Italy, Austria, the Czech Republic, Slovakia, Poland, Hungary, Romania, Bulgaria, North Macedonia, Albania, Bosnia and Herzegovina and Croatia. The larvae feed on Doronicum austriacum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix doronicella has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections14

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

28Amostly conserved

61Gmostly conserved

68Gmostly conserved

160Amostly conserved

166Amostly conserved

217Gmostly conserved

220Amostly conserved

223Gvariable

268Amostly conserved

358Tmostly conserved

364Avariable

451Cvariable

506Gmostly conserved

579Tmostly conserved

625Avariable

634Tmostly conserved

AACATTATATTTCATCTTCGGAATTTGAGCAGGAATAGTTGGCACATCTTTAAGATTATTGATTCGTGCTGAATTAGGTAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes6

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus5.8%Agonopterix kaekeritzianasame genus6.1%Agonopterix broennoeensissame genus6.2%Agonopterix squamosasame genus6.2%Agonopterix oregonensissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor10

Museum / vouchered3

Other2

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 2≤10 km 6

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	2

1 institutions · 2 of 3 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Agonopterix doronicella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.4–20.6

Seasonal swing summer↔winter19.7 °C

Max temp (day)18.5 °C 15.5–24.1

Min temp (night)9.20 °C 6.20–16.1

Precipitation101 mm/mo 46.7–138

Air humidity58.3 % 54.6–63.3

Moisture balance-23.4 mm/mo -103–28.5

Vapour deficit678 Pa 503–1,102

Wind speed2.30 m/s 2.20–3.60

Cloud cover33.1 % 24.3–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)