Agonoleptus conjunctus

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonoleptus

At a glance

Occurrence records1 205

Data sources8

Biological traits0

DNA specimens178

eDNA detections200

Sources8 archives

Databases and archives Agonoleptus conjunctus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI200 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics178 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 205 records

Environmental DNA1 datasets · 2 countries200 detections

DNA & barcodingBOLD178 specimens

01Narrative

Agonoleptus conjunctus is a species of ground beetle in the family Carabidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding178 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonoleptus conjunctus has left across the world's sequence archives.

At a glance

DNA specimens178

BINs1

Marker genes1

eDNA detections200

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus161 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

52Amostly conserved

312Gmostly conserved

403Gvariable

628Gvariable

AACATTATATTTTATTTTCGGAGTATGAGCAGGGATAGTAGGAACTTCTTTAAGTATACTAATTCGAGCTGAATTAGGAACCCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes32

BIN1

Most divergent pair1.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonoleptus rotundatussame genus4.7%Anisodactylus furvussame family8.1%Harpalus attenuatussame family8.1%Anisodactylus discoideussame family8.4%Acupalpus luteatussame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 205 records

Wild obs. + sensor13

Museum / vouchered1 192

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 7≤1 km 2≤10 km 3>10 km 1

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 758≤1 km 2≤10 km 92>10 km 77

929 georeferenced · 263 without coordinates

Open the institutions mapphysical evidence1 192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	751
Royal Saskatchewan Museumlocation not on record	87
Lexington, US	77
Essig Museum of Entomologylocation not on record	68
Champaign, US	58
College Station, US	20
NEON Biorepository at Arizona State Universitylocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Biodiversity Institute of Ontariolocation not on record	4
Provo, US	4
Decorah, US	4
OSUClocation not on record	4
CUlocation not on record	3
Awka, NG	2
San Francisco, US	2
SOVTlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
EWIClocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

19 institutions · 1 106 of 1 192 vouchered records shown · 86 without an institution code

09Environmental DNA200 detections

Where the DNA of Agonoleptus conjunctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found200

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 200 detections have coordinates

Open the map2 countries0

grasslandHerbaceouscultivatedCropspastureHayfarmevergreenForest1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 10.5–24.6

Seasonal swing summer↔winter25.5 °C

Max temp (day)23.0 °C 17.2–31.0

Min temp (night)12.7 °C 5.80–19.4

Precipitation88.1 mm/mo 49.4–128

Air humidity55.9 % 50.4–59.7

Moisture balance-59.3 mm/mo -112–3.30

Vapour deficit842 Pa 572–1,392

Wind speed3.70 m/s 2.20–5.20

Cloud cover38.1 % 24.4–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 197 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonoleptus conjunctus

At a glance

Sources8 archives

At a glance

Record type1 205 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 205 records