Agoma trimenii

Felder, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agoma

At a glance

Occurrence records339

Data sources7

Biological traits0

DNA specimens18

eDNA detections28

Sources7 archives

Databases and archives Agoma trimenii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF339 records

Environmental DNA1 datasets · 7 countries28 detections

DNA & barcodingBOLD18 specimens

01Narrative

Agoma is a monotypic moth genus of the family Noctuidae erected by Sergius G. Kiriakoff in 1977. Its only species, Agoma trimenii, or Trimen's false tiger, was first described by Rudolf Felder in 1874. It is known from most countries of subtropical Africa."Agoma trimenii (Felder, 1874)". African Moths. Retrieved November 17, 2020.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agoma trimenii has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections28

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

2Amostly conserved

31Tmostly conserved

40Gvariable

67Amostly conserved

100Amostly conserved

160Gmostly conserved

208Amostly conserved

235Tmostly conserved

317Gmostly conserved

340Tmostly conserved

368Gmostly conserved

379Amostly conserved

433Amostly conserved

548Cmostly conserved

628Gvariable

AACATTATATTTTATTTTTGGTATTTGATCTGGAATAGTGGGAACTTCCCTTAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes8

BIN1

Most divergent pair0.76%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neotuerta sabulosasame family4.9%Mimeusemia simplexsame family5.2%Mimeusemia centralissame family5.2%Euscirrhopterus klagesisame family5.3%Alypiodes geronimosame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type339 records

Wild obs. + sensor333

Museum / vouchered6

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 168≤1 km 41≤10 km 16

225 georeferenced · 108 without coordinates

Open the mapobservation + sensor333

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	2
Helsinki, FI	1
Durban Natural Science Museumlocation not on record	1
National Museums of Kenyalocation not on record	1

4 institutions · 5 of 6 vouchered records shown · 1 without an institution code

09Environmental DNA28 detections

Where the DNA of Agoma trimenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map7 countries0

ForestMixed habitatAlluvial Plains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.0–23.3

Seasonal swing summer↔winter8.90 °C

Max temp (day)26.9 °C 25.0–28.4

Min temp (night)16.6 °C 14.7–18.6

Precipitation85.8 mm/mo 66.9–115

Air humidity58.8 % 53.7–62.6

Moisture balance-56.6 mm/mo -75.9–-24.8

Vapour deficit1,099 Pa 938–1,271

Wind speed2.70 m/s 2.20–4.30

Cloud cover33.4 % 25.2–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)