Agolambrus agonus

(Stimpson, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Parthenopidae/Agolambrus

At a glance

Occurrence records975

Data sources8

Biological traits4

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Agolambrus agonus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility429 records↗

OBISOcean Biodiversity Information System546 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS975 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Agolambrus agonus is een krabbensoort uit de familie van de Parthenopidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door Stimpson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max391 m

Depth min46 m

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agolambrus agonus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACCTTATATTTTATCTTTGGAGTTTGAGCTGGAATAGTAGGAACATCTTTAAGTTTAATCATTCGAGCTGAACTTGGACAACCAGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Distolambrus maltzamisame family13.1%Enoplolambrus validussame family13.6%Selatium brockiisame order14.0%Elymiotis complicatasame order16.3%Pygospila marginalissame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type975 records

Wild obs. + sensor93

Museum / vouchered882

Range

Area of Occupancy AOO1 656 km²

Depth

0–200 m sunlit421

200–1000 m twilight18

1–4 km midnight1

>4 km abyssal0

median 70.9 m · max 1 803 m · 440 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 88 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 10≤1 km 75≤10 km 1

86 georeferenced · 796 without coordinates

Open the institutions mapphysical evidence882

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	49
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	34
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	23
Paris, FR	15
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	4
FCMMlocation not on record	4
Los Angeles, US	3
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
UM-RSMASlocation not on record	1

11 institutions · 137 of 882 vouchered records shown · 287 without an institution code

09Environmental DNA3 detections

Where the DNA of Agolambrus agonus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.9

Seasonal swing summer↔winter7.40 °C

Max temp (day)27.0 °C 27.0–27.8

Min temp (night)25.4 °C 25.4–25.9

Precipitation151 mm/mo 151–192

Air humidity60.2 % 60.2–61.3

Vapour deficit1,343 Pa 1,343–1,365

Cloud cover29.2 % 29.2–29.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)