Agnippe prunifoliella

(Chambers, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Agnippe

At a glance

Occurrence records311

Data sources8

Biological traits0

DNA specimens57

eDNA detections57

Sources8 archives

Databases and archives Agnippe prunifoliella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF311 records

Environmental DNA1 datasets · 2 countries57 detections

DNA & barcodingBOLD57 specimens

01Narrative

Agnippe prunifoliella is a moth in the family Gelechiidae. It is found in North America, where it has been recorded from Alabama, Alberta, Arizona, Arkansas, British Columbia, California, Florida, Illinois, Indiana, Kansas, Kentucky, Louisiana, Maine, Maryland, Mississippi, North Carolina, Oklahoma, Quebec, South Carolina, Tennessee, Texas and West Virginia.Agnippe at funetmothphotographersgroup The forewings are dark greyish brown, but white along the posterior margin, the line between the two colours scalloped, or rather the white portion sends two or three teeth or processes into the brownish part, one of which is just before the cilia and is opposite to a costal white streak. The dorsal cilia are dusky silvery dusted with dark brown. The hindwings are pale yellowish fuscous.Can. Ent. 5 (10): 186 The larvae feed on Prunus americana.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnippe prunifoliella has left across the world's sequence archives.

At a glance

DNA specimens57

BINs6

Marker genes1

eDNA detections57

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

4Tmostly conserved

5Cvariable

22Tmostly conserved

38Gmostly conserved

40Tmostly conserved

43Tmostly conserved

67Tvariable

74Tmostly conserved

85Avariable

88Tmostly conserved

91Tmostly conserved

100Amostly conserved

127Amostly conserved

136Tmostly conserved

157Cvariable

184Gvariable

190Cvariable

202Tvariable

205Amostly conserved

214Tmostly conserved

220Tvariable

232Cvariable

235Tmostly conserved

238Cmostly conserved

250Cmostly conserved

256Amostly conserved

263Tvariable

265Avariable

266Tmostly conserved

271Tmostly conserved

274Tvariable

278Cmostly conserved

283Tmostly conserved

284Tmostly conserved

319Tmostly conserved

322Amostly conserved

337Tmostly conserved

349Tmostly conserved

361Tmostly conserved

364Tmostly conserved

367Cvariable

373Amostly conserved

376Amostly conserved

382Tmostly conserved

385Tmostly conserved

386Tmostly conserved

394Cvariable

403Amostly conserved

407Tmostly conserved

412Tmostly conserved

421Cvariable

427Tmostly conserved

439Tmostly conserved

448Tmostly conserved

469Amostly conserved

481Tmostly conserved

484Amostly conserved

499Cvariable

500Cmostly conserved

502Tmostly conserved

514Tmostly conserved

517Tvariable

526Tmostly conserved

529Cvariable

539Cmostly conserved

541Tmostly conserved

542Tmostly conserved

550Amostly conserved

556Tmostly conserved

562Tmostly conserved

565Tmostly conserved

568Amostly conserved

574Cvariable

578Cmostly conserved

580Tmostly conserved

586Amostly conserved

592Amostly conserved

607Tmostly conserved

616Tmostly conserved

625Tvariable

628Amostly conserved

640Tmostly conserved

641Cvariable

643Avariable

646Cvariable

AACTCTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACTTCTTTAAGTTTATTAATTCGTGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.5%

Haplotypes12

BINs6

Most divergent pair7.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnippe abditasame genus6.2%Agnippe albidorsellasame genus7.0%Agnippe echinuloidessame genus7.8%Agnippe laudatellasame genus8.7%Piletocera macroperalissame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type311 records

Wild obs. + sensor205

Museum / vouchered106

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 116≤1 km 21≤10 km 9>10 km 14

160 georeferenced · 45 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 1≤10 km 3

9 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	70
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Washington, US	4
University of Alberta Museums (UAM)location not on record	4
East Lansing, US	3
Royal Saskatchewan Museumlocation not on record	2
Denver, US	2
St. Paul, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
San Francisco, US	1

10 institutions · 97 of 106 vouchered records shown · 9 without an institution code

09Environmental DNA57 detections

Where the DNA of Agnippe prunifoliella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map2 countries0

Forest4. Native Grasslandat MVL

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 14.0–23.9

Seasonal swing summer↔winter24.8 °C

Max temp (day)22.1 °C 17.7–29.4

Min temp (night)13.1 °C 9.40–19.7

Precipitation86.2 mm/mo 27.8–131

Air humidity59.8 % 54.9–62.8

Moisture balance-43.8 mm/mo

Vapour deficit828 Pa 610–1,265

Wind speed2.70 m/s

Cloud cover43.9 % 31.4–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)