Agnidra scabiosa

(Butler, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Drepanidae/Agnidra

At a glance

Occurrence records310

Data sources7

Biological traits0

DNA specimens32

eDNA detections29

Sources7 archives

Databases and archives Agnidra scabiosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF310 records

Environmental DNA1 datasets · 4 countries29 detections

DNA & barcodingBOLD32 specimens

01Narrative

Agnidra scabiosa is a moth in the family Drepanidae. It was described by Arthur Gardiner Butler in 1877. It is found in south-eastern Russia, Korea, Japan and China.Agnidra at Markku Savela's Lepidoptera and Some Other Life Forms The wingspan is 14-17.5 mm for males and 17.5–20 mm for females. Adults are similar to Agnidra fuscilinea, but have a distinctive colour pattern of the wings.Bulletin of the British Museum (Natural History) (Entomology) Suppl. 12 The larvae feed on Quercus and Castanea species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnidra scabiosa has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections29

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

1Amostly conserved

6Amostly conserved

11Amostly conserved

13Amostly conserved

14Tmostly conserved

17Gmostly conserved

19Amostly conserved

67Cmostly conserved

76Tmostly conserved

89Cmostly conserved

103Tmostly conserved

142Tmostly conserved

194Cmostly conserved

223Tmostly conserved

232Cmostly conserved

247Tmostly conserved

262Amostly conserved

268Cmostly conserved

283Cmostly conserved

337Tmostly conserved

340Tmostly conserved

346Tmostly conserved

361Cmostly conserved

364Tmostly conserved

373Cmostly conserved

400Cmostly conserved

424Cmostly conserved

425Tmostly conserved

433Tmostly conserved

529Cmostly conserved

586Tmostly conserved

604Cmostly conserved

613Cmostly conserved

ATTATATTTTATATTTGGAATTTGAGCAGGTATAATTGGAACATCTTTAAGACTTTTAATTCGTGCCGAATTAGGTAATCCAGGATCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes4

BINs2

Most divergent pair4.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix abditellasame order9.0%Agonopterix latipennellasame order9.0%Rhesala fusiformissame order9.3%Depressaria paraleucocephalasame order9.6%Hypsidia robinsonisame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_065770 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type310 records

Wild obs. + sensor81

Museum / vouchered229

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 36≤1 km 20≤10 km 9>10 km 3

68 georeferenced · 13 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 108≤1 km 9

117 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence229

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hiwa Museum of Natural Historylocation not on record	108
Gifu prefectural Museumlocation not on record	59
Kawasaki Shi Tama Ku, JP	26
Philadelphia, US	17
Tartu, EE	9
Chiba, JP	4
Toyota city nature sanctuarylocation not on record	2
ZSMlocation not on record	1
RCMlocation not on record	1

9 institutions · 227 of 229 vouchered records shown · 2 without an institution code

09Environmental DNA29 detections

Where the DNA of Agnidra scabiosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 17.5–25.2

Seasonal swing summer↔winter21.3 °C

Max temp (day)26.5 °C 20.8–27.3

Min temp (night)22.0 °C 13.1–23.8

Precipitation257 mm/mo 195–424

Air humidity68.4 % 60.6–69.2

Moisture balance120 mm/mo 58.3–289

Vapour deficit961 Pa 771–1000

Wind speed2.30 m/s 1.40–4.20

Cloud cover41.7 % 39.7–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)