Agnetina capitata

(Pictet, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Perlidae/Agnetina

At a glance

Occurrence records5 508

Data sources8

Biological traits0

DNA specimens103

eDNA detections124

Sources8 archives

Databases and archives Agnetina capitata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 508 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI124 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics103 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 508 records

Environmental DNA1 datasets · 2 countries124 detections

DNA & barcodingBOLD103 specimens

01Narrative

Agnetina capitata, the northern stone, is a species of common stonefly in the family Perlidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding103 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnetina capitata has left across the world's sequence archives.

At a glance

DNA specimens103

BINs3

Marker genes2

eDNA detections124

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

5Cmostly conserved

31Cmostly conserved

40Gmostly conserved

49Amostly conserved

50Tmostly conserved

59Tmostly conserved

67Amostly conserved

79Tmostly conserved

88Tmostly conserved

91Tmostly conserved

112Tmostly conserved

133Tmostly conserved

136Tmostly conserved

142Cmostly conserved

154Tmostly conserved

157Tmostly conserved

166Amostly conserved

181Amostly conserved

187Tmostly conserved

190Tmostly conserved

220Cmostly conserved

235Tmostly conserved

250Tmostly conserved

259Cmostly conserved

262Gmostly conserved

271Amostly conserved

277Tmostly conserved

286Cmostly conserved

292Gmostly conserved

295Tmostly conserved

298Amostly conserved

302Cmostly conserved

316Amostly conserved

319Amostly conserved

325Gmostly conserved

349Gmostly conserved

358Gmostly conserved

370Tmostly conserved

373Tmostly conserved

376Tmostly conserved

394Tmostly conserved

400Tmostly conserved

403Gmostly conserved

415Tmostly conserved

421Tmostly conserved

448Cmostly conserved

451Cvariable

454Gmostly conserved

469Gmostly conserved

472Tmostly conserved

475Tmostly conserved

478Cmostly conserved

484Tmostly conserved

496Gmostly conserved

499Amostly conserved

508Tmostly conserved

517Amostly conserved

523Tmostly conserved

529Tmostly conserved

532Cmostly conserved

535Cmostly conserved

538Tmostly conserved

544Tmostly conserved

547Tmostly conserved

548Tmostly conserved

553Gmostly conserved

559Gmostly conserved

562Tmostly conserved

589Cmostly conserved

596Tmostly conserved

601Cmostly conserved

604Cmostly conserved

607Amostly conserved

610Tmostly conserved

613Tmostly conserved

616Tmostly conserved

619Tmostly conserved

634Cmostly conserved

641Tmostly conserved

643Gvariable

AACTCTATACTTCATCTTTGGAGCTTGATCCGGTATGGTGGGAACATCATTAAGACTTTTAATTCGAGCAGAATTAGGTCAACCCGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.6%

Haplotypes8

BINs2

Most divergent pair12.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnetina elegantulasame genus11.1%Agnetina flavescenssame genus11.2%Agnetina annulipessame genus12.2%Agnetina brevipennissame genus12.4%Drosophila kuntzeisame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type5 508 records

Wild obs. + sensor4 294

Museum / vouchered1 214

Range

Area of Occupancy AOO4 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4 275≤1 km 6>10 km 3

4 284 georeferenced · 10 without coordinates

Open the mapobservation + sensor4 294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 405≤1 km 435≤10 km 235>10 km 22

1 097 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence1 214

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	650
UWIRClocation not on record	185
UIHygenicslocation not on record	55
UMSPlocation not on record	42
ISIClocation not on record	23
OEPAlocation not on record	22
Chicago, US	18
MSUARClocation not on record	17
OSUClocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
Provo, US	10
The Atlantic reference Centrelocation not on record	10
SIUC-INHSlocation not on record	8
Ann Arbor, US	7
Cornell University Insect Collectionlocation not on record	5
CNClocation not on record	4
Tempe, US	4
Washington, US	3
BYUClocation not on record	3
Cleveland Museum of Natural Historylocation not on record	3
PNHClocation not on record	3
INHS Insect Collectionlocation not on record	2
WKUClocation not on record	2
Wuzhou, CN	2
USNMENTlocation not on record	1
C.P. Gillette Museum of Arthropod Diversitylocation not on record	1
Canadian National Collection Insectslocation not on record	1
Illinois Natural History Surveylocation not on record	1
University Park, US	1
Purdue Entomological Research Collectionlocation not on record	1
CUlocation not on record	1
NDUClocation not on record	1

32 institutions · 1 109 of 1 214 vouchered records shown · 105 without an institution code

09Environmental DNA124 detections

Where the DNA of Agnetina capitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found124

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 124 detections have coordinates

Open the map2 countries0

Riffle

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 0.1–18.9

Seasonal swing summer↔winter28.0 °C

Max temp (day)23.4 °C 5.30–24.0

Min temp (night)14.2 °C -4.70–14.8

Precipitation103 mm/mo 72.2–119

Air humidity60.0 % 58.2–60.5

Moisture balance-14.5 mm/mo -20.6–47.9

Vapour deficit831 Pa 266–860

Wind speed2.50 m/s 2.40–3.90

Cloud cover50.9 % 48.3–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agnetina capitata

At a glance

Sources8 archives

At a glance

Record type5 508 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 508 records