Aglossa caprealis

(Hübner) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Aglossa

At a glance

Occurrence records3 844

Data sources7

Biological traits0

DNA specimens21

eDNA detections18

Sources7 archives

Databases and archives Aglossa caprealis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 844 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 844 records

Environmental DNA1 datasets · 6 countries18 detections

DNA & barcodingBOLD21 specimens

01Narrative

Aglossa caprealis, the stored grain moth, is a moth species of the family Pyralidae. It is found globally, though its native range is presumably the western Palearctic or nearby regions, as in other Aglossa species. The wingspan is 23–27 mm. The moth flies from June to August, depending on the location. Figs.5. 5a, 5b, 5c, 5d larvae in various stages 5e case The larvae feed on dry plant waste, grain (e.g. maize), hay, straw and decaying manure. Sometimes, they even eat animal carcasses, suet, lard, pork rinds and other fatty materials.Grabe (1942)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglossa caprealis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs4

Marker genes1

eDNA detections18

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 115 variable positions, in barcode order

1Amostly conserved

19Tmostly conserved

34Tmostly conserved

40Tmostly conserved

46Tmostly conserved

49Tmostly conserved

58Cmostly conserved

67Amostly conserved

70Tmostly conserved

79Tmostly conserved

82Tmostly conserved

85Cmostly conserved

88Amostly conserved

92Tmostly conserved

100Amostly conserved

106Tmostly conserved

112Tmostly conserved

115Tmostly conserved

124Cvariable

127Amostly conserved

145Tmostly conserved

154Tmostly conserved

169Tmostly conserved

178Tmostly conserved

181Amostly conserved

184Tmostly conserved

202Tmostly conserved

205Tmostly conserved

206Tmostly conserved

208Amostly conserved

212Tmostly conserved

217Gmostly conserved

220Cmostly conserved

223Cmostly conserved

229Amostly conserved

232Tmostly conserved

253Amostly conserved

256Amostly conserved

262Amostly conserved

263Tmostly conserved

266Tmostly conserved

268Amostly conserved

278Tmostly conserved

280Amostly conserved

286Cmostly conserved

287Cmostly conserved

289Tmostly conserved

298Tmostly conserved

316Gmostly conserved

322Tmostly conserved

325Tmostly conserved

328Tmostly conserved

334Tmostly conserved

340Tmostly conserved

343Tmostly conserved

346Tmostly conserved

352Tmostly conserved

355Tmostly conserved

358Tmostly conserved

364Amostly conserved

367Cmostly conserved

370Tmostly conserved

376Tmostly conserved

379Amostly conserved

382Amostly conserved

386Tmostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

409Gmostly conserved

412Amostly conserved

421Cmostly conserved

433Gmostly conserved

436Tmostly conserved

439Tmostly conserved

451Cmostly conserved

454Tmostly conserved

463Tmostly conserved

481Tmostly conserved

484Amostly conserved

500Tmostly conserved

508Tmostly conserved

514Amostly conserved

517Tmostly conserved

526Amostly conserved

529Cmostly conserved

542Tvariable

544Amostly conserved

547Avariable

553Tmostly conserved

556Tmostly conserved

557Cmostly conserved

562Amostly conserved

568Tmostly conserved

574Tmostly conserved

578Tmostly conserved

580Amostly conserved

581Cmostly conserved

583Tmostly conserved

586Cmostly conserved

592Tmostly conserved

595Tmostly conserved

596Tmostly conserved

598Amostly conserved

604Tvariable

613Tmostly conserved

616Tmostly conserved

619Tmostly conserved

622Tmostly conserved

628Gvariable

631Amostly conserved

637Tmostly conserved

641Cmostly conserved

643Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACTTCTTTAAGTCTCTTAATTCGAGCTGAATTAGGTAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes7

BINs4

Most divergent pair12.9%

EuropeOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aglossa signicostalissame genus6.3%Grammiphlebia striatasame family7.6%Orthopygia glaucinalissame family8.1%Arescoptera haplocalasame family8.5%Arescoptera idiotypasame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 844 records

Wild obs. + sensor3 620

Museum / vouchered211

Other13

Origin

Native5

Introduced14

Range

Area of Occupancy AOO8 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 1 063≤1 km 616≤10 km 1 054>10 km 228

2 961 georeferenced · 659 without coordinates

Open the mapobservation + sensor3 620

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 9≤1 km 17≤10 km 66>10 km 36

128 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	31
Zürich, CH	25
Philadelphia, US	22
North Carolina State University Insect Museumlocation not on record	15
New Haven, US	14
San Diego, US	12
Georgia Museum of Natural Historylocation not on record	12
East Lansing, US	8
Natural History Museum Rotterdamlocation not on record	8
Mississippi State, US	6
Auckland, NZ	5
Nijmegen, NL	4
Washington, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Tartu, EE	3
Decorah, US	3
DanishLepidopterologicalSocietylocation not on record	3
US	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Australian National Insect Collectionlocation not on record	2
Hungarian Natural History Museumlocation not on record	2
Sydney, AU	2
SOVTlocation not on record	1
Provincia di Livornolocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Ugentlocation not on record	1
University of Kaiserslauternlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
CBDClocation not on record	1
SFRAlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
New Zealand Arthropod Collectionlocation not on record	1
MWLRlocation not on record	1
ZAF-UMUlocation not on record	1

34 institutions · 200 of 211 vouchered records shown · 11 without an institution code

09Environmental DNA18 detections

Where the DNA of Aglossa caprealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map6 countries0

ForestHouse (Synanthropic Species)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 16.5–22.0

Seasonal swing summer↔winter13.9 °C

Max temp (day)22.4 °C 19.8–27.0

Min temp (night)13.6 °C 12.7–17.0

Precipitation70.1 mm/mo 30.7–117

Air humidity58.9 % 54.7–62.8

Moisture balance-51.1 mm/mo -125–-8.30

Vapour deficit854 Pa 714–1,185

Wind speed3.10 m/s 2.00–4.30

Cloud cover33.0 % 21.4–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglossa caprealis

At a glance

Sources7 archives

At a glance

Record type3 844 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 844 records