Aglossa cacamica

Dyar, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Aglossa

At a glance

Occurrence records194

Data sources7

Biological traits0

DNA specimens7

eDNA detections5

Sources7 archives

Databases and archives Aglossa cacamica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF194 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aglossa cacamica is a species of snout moth in the genus Aglossa. It was described by Harrison Gray Dyar Jr. in 1913. It is found in North America, including California. The wingspan is 22–34 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglossa cacamica has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

22Tmostly conserved

43Tmostly conserved

46Cvariable

56Tmostly conserved

58Amostly conserved

64Cmostly conserved

82Tmostly conserved

87Amostly conserved

91Cmostly conserved

118Tmostly conserved

127Amostly conserved

136Tmostly conserved

181Amostly conserved

208Tmostly conserved

220Tmostly conserved

232Tmostly conserved

235Cmostly conserved

265Tmostly conserved

266Tmostly conserved

268Amostly conserved

274Cvariable

292Tmostly conserved

294Tmostly conserved

343Cmostly conserved

346Cmostly conserved

347Tmostly conserved

364Cmostly conserved

367Tmostly conserved

379Tmostly conserved

386Cmostly conserved

397Cmostly conserved

424Tmostly conserved

433Gvariable

454Cvariable

463Tmostly conserved

478Tmostly conserved

508Cmostly conserved

553Tmostly conserved

602Amostly conserved

616Cmostly conserved

619Avariable

634Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCAGGTATAATTGGTACCTCTTTAAGATTATTAATCCGAACTGAATTAGGTAATCCTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes3

BINs2

Most divergent pair5.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hypsopygia cohortalissame family3.2%Aglossa babasame genus5.8%Aglossa disciferalissame genus6.5%Aglossa costiferalissame genus6.8%Aglossa cuprinasame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type194 records

Wild obs. + sensor29

Museum / vouchered165

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 5≤1 km 17≤10 km 2>10 km 1

25 georeferenced · 4 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 6≤1 km 26≤10 km 48>10 km 19

99 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	88
Santa Barbara Museum of Natural Historylocation not on record	48
Washington, US	12
New Haven, US	4
Mississippi State, US	4
San Francisco, US	3
ASUlocation not on record	1
Colorado State Universitylocation not on record	1
Oregon State Arthropod Collectionlocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Essig Museum of Entomologylocation not on record	1
Denver, US	1

12 institutions · 165 of 165 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Aglossa cacamica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 21.0–24.4

Seasonal swing summer↔winter11.5 °C

Max temp (day)28.8 °C 28.8–31.8

Min temp (night)15.9 °C 15.8–17.7

Precipitation1.10 mm/mo 1.10–65.3

Air humidity53.5 % 45.6–53.5

Moisture balance-157 mm/mo -182–-110

Vapour deficit1,152 Pa 1,152–1,623

Wind speed1.40 m/s 1.40–3.20

Cloud cover9.20 % 9.20–19.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)