Aglaophenia latecarinata

Allman, 1877 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Leptothecata/Aglaopheniidae/Aglaophenia

At a glance

Occurrence records703

Data sources7

Biological traits5

DNA specimens7

eDNA detections14

Sources7 archives

Databases and archives Aglaophenia latecarinata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility422 records↗

OBISOcean Biodiversity Information System281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS703 records

Environmental DNA4 datasets · 6 countries14 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aglaophenia latecarinata is een hydroïdpoliep uit de familie Aglaopheniidae. De poliep komt uit het geslacht Aglaophenia. Aglaophenia latecarinata werd in 1877 voor het eerst wetenschappelijk beschreven door Allman.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max516 m

Depth min0 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaophenia latecarinata has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections14

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P357 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

14Cvariable

23Cvariable

26Cvariable

38Cvariable

47Tmostly conserved

74Tmostly conserved

80Cmostly conserved

83Cmostly conserved

86Tvariable

89Gvariable

92Tvariable

107Amostly conserved

119Cmostly conserved

179Tmostly conserved

192Tmostly conserved

216Cmostly conserved

230Cvariable

231Cvariable

239Tvariable

242Tmostly conserved

255Tvariable

269Tvariable

275Tvariable

293Tmostly conserved

302Avariable

320Tmostly conserved

327Cmostly conserved

338Tmostly conserved

341Tmostly conserved

GATGAACAGTTTACCCCCCACTCTCCGGTCCTATAGCCCACTCAGGTAGTTCAGTTGATTTAGCTATATTTAGTTTACACTGCGCTGGGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes3

BINs2

Most divergent pair5.0%

OtherN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type703 records

Wild obs. + sensor92

Museum / vouchered599

Other12

Origin

Native14

Range

Area of Occupancy AOO1 116 km²

Depth

0–200 m sunlit58

200–1000 m twilight34

1–4 km midnight8

>4 km abyssal1

median 70 m · max 4 332 m · 101 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 4≤1 km 3≤10 km 11>10 km 9

27 georeferenced · 65 without coordinates

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 3≤1 km 112≤10 km 2>10 km 29

146 georeferenced · 453 without coordinates

Open the institutions mapphysical evidence599

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	46
RBINS-Scientific Heritagelocation not on record	38
FCMMlocation not on record	17
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	16
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	14
Texas Cooperative Wildlife Collectionlocation not on record	14
Toronto, CA	14
Washington, US	14
Masindi, UG	10
UM-RSMASlocation not on record	9
Stockholm, SE	7
NTNU-VMlocation not on record	5
New Haven, US	4
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
WoRMS Editorial Boardlocation not on record	2
Copenhagen, DK	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Paris, FR	1
National Marine Biodiversity Institute of Korealocation not on record	1
South Kensington, GB	1
Ifremerlocation not on record	1

21 institutions · 219 of 599 vouchered records shown · 144 without an institution code

09Environmental DNA14 detections

Where the DNA of Aglaophenia latecarinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys4

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map6 countries0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 24.7–26.3

Seasonal swing summer↔winter2.70 °C

Max temp (day)26.3 °C 26.1–27.3

Min temp (night)24.9 °C 22.6–25.4

Precipitation82.7 mm/mo 48.4–225

Air humidity61.8 % 59.4–65.0

Vapour deficit1,232 Pa 1,163–1,293

Cloud cover24.1 % 22.1–32.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)