Aglaope infausta

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Zygaenidae/Aglaope

At a glance

Occurrence records3 025

Data sources7

Biological traits0

DNA specimens11

eDNA detections10

Sources7 archives

Databases and archives Aglaope infausta's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 025 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 025 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Aglaope infausta (almond-tree leaf skeletonizer moth) is a moth of the family Zygaenidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaope infausta has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P597 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.58%

Haplotypes2

BIN1

Most divergent pair0.17%

Where individuals differ — all 10 variable positions, in barcode order

9Tmostly conserved

24Cmostly conserved

39Amostly conserved

45Cmostly conserved

105Gmostly conserved

129Gmostly conserved

141Amostly conserved

186Cmostly conserved

456Gvariable

564Avariable

ATTCGAGCTGAATTAGGAAATCCCGGCTCTTTAATTGGAGATGACCAAATTTATAATACAATTGTAACAGCCCATGCTTTTATTATAATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coleophora lithargyrinellasame order11.2%Corynotricha antipodellasame order11.4%Parocystola leucosporasame order11.6%Eucoptocnemis optabilissame order11.6%Plectobela zanclotomasame order11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type3 025 records

Wild obs. + sensor2 767

Museum / vouchered257

Other1

Origin

Native53

Range

Area of Occupancy AOO4 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 522≤1 km 364≤10 km 1 333>10 km 55

2 274 georeferenced · 493 without coordinates

Open the mapobservation + sensor2 767

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 7≤1 km 88≤10 km 28>10 km 44

167 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	66
Vitoria, ES	54
John May Museum of Natural Historylocation not on record	20
Nijmegen, NL	16
Natural History Museum Rotterdamlocation not on record	6
Sion, CH	5
Philadelphia, US	5
Tartu, EE	3
Bern, CH	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
UGRlocation not on record	1
Zentrum fur Biodokumentation des Saarlandeslocation not on record	1
Research Collection of Rudolf Tannertlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

14 institutions · 183 of 257 vouchered records shown · 74 without an institution code

09Environmental DNA10 detections

Where the DNA of Aglaope infausta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 16.2–17.6

Seasonal swing summer↔winter14.9 °C

Max temp (day)21.8 °C 20.7–22.1

Min temp (night)10.4 °C 10.4–12.2

Precipitation41.5 mm/mo 41.5–65.0

Air humidity58.1 % 58.1–58.4

Moisture balance-114 mm/mo -114–-65.3

Vapour deficit795 Pa 769–840

Wind speed3.90 m/s 3.30–3.90

Cloud cover37.7 % 35.4–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglaope infausta

At a glance

Sources7 archives

At a glance

Record type3 025 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 025 records