Aglaoctenus lagotis

(Holmberg, 1876) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Aglaoctenus

At a glance

Occurrence records1 743

Data sources8

Biological traits3

DNA specimens417

eDNA detections242

Sources8 archives

Databases and archives Aglaoctenus lagotis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 743 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI242 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics417 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF1 743 records

Environmental DNA1 datasets · 3 countries242 detections

DNA & barcodingBOLD417 specimens

01Narrative

Aglaoctenus lagotis is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Aglaoctenus. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1876 door Holmberg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCraig et al. 2020

Biomechanics3

Silk strain0.38 mm

Silk strength401 mm

Silk toughness96.55 mm

05DNA & barcoding417 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaoctenus lagotis has left across the world's sequence archives.

At a glance

DNA specimens417

BINs5

Marker genes3

eDNA detections242

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P228 bp consensus384 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

15Tvariable

46Gmostly conserved

54Gvariable

57Tmostly conserved

60Amostly conserved

66Gvariable

72Tmostly conserved

75Amostly conserved

84Gmostly conserved

87Gmostly conserved

114Tvariable

117Amostly conserved

121Tmostly conserved

151Tmostly conserved

154Tmostly conserved

156Amostly conserved

168Tmostly conserved

171Tvariable

180Tmostly conserved

189Tvariable

204Gmostly conserved

ATAGGTGCTGTAAATTTTATTTCTACTATTATTAATATACGATTAGTAGGAATGTCTATAGAAAAGGTATCTTTATTTGTTTGGTCGGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 39 commonest of 57 variants.

Diversity (π)3.2%

Haplotypes57

BINs5

Most divergent pair8.3%

S.AmericaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-3P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type1 743 records

Wild obs. + sensor1 375

Museum / vouchered320

Other48

Range

Area of Occupancy AOO3 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 528≤1 km 374≤10 km 148>10 km 63

1 113 georeferenced · 262 without coordinates

Open the mapobservation + sensor1 375

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 24≤10 km 68>10 km 8

100 georeferenced · 220 without coordinates

Open the institutions mapphysical evidence320

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	199
Buenos Aires, AR	98
Museu Paraense Emílio Goeldilocation not on record	10
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	7
Cambridge, US	5
PUC-RSlocation not on record	1

6 institutions · 320 of 320 vouchered records shown

09Environmental DNA242 detections

Where the DNA of Aglaoctenus lagotis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found242

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 242 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 209 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglaoctenus lagotis

At a glance

Sources8 archives

Biomechanics3

At a glance

Record type1 743 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 743 records