Aglantha digitale

(O.F.Müller, 1776) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Trachymedusae/Rhopalonematidae/Aglantha

At a glance

Occurrence records35 991

Data sources11

Biological traits1

DNA specimens80

eDNA detections2 919

Sources11 archives

Databases and archives Aglantha digitale's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 927 records↗

OBISOcean Biodiversity Information System23 064 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 919 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS35 991 records

Environmental DNA9 datasets · 15 countries2 919 detections

DNA & barcodingBOLD80 specimens

Genome at a glanceGoaT · NCBI1.5 Gbp

01Narrative

Aglantha digitale is a species of hydrozoan in the family Rhopalonematidae. It is found in the Arctic and sub-Arctic where it is one of the most common jellyfish. It is unusual in having both a slow swimming action, through pulsating its bell, and a rapid escape response.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglantha digitale has left across the world's sequence archives.

At a glance

DNA specimens80

BINs3

Marker genes5

eDNA detections2 919

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

39Tmostly conserved

63Amostly conserved

90Cmostly conserved

93Cvariable

102Cvariable

111Tvariable

120Avariable

123Cvariable

138Tvariable

141Tmostly conserved

165Tmostly conserved

192Amostly conserved

258Tvariable

261Cvariable

303Avariable

334Tvariable

381Avariable

423Cvariable

432Tvariable

438Avariable

450Cmostly conserved

459Tvariable

462Tvariable

489Avariable

513Tvariable

522Amostly conserved

531Avariable

537Tvariable

543Cvariable

547Gmostly conserved

548Cmostly conserved

549Tmostly conserved

550Gmostly conserved

554Cmostly conserved

555Amostly conserved

557Tmostly conserved

558Amostly conserved

560Cmostly conserved

561Tvariable

562Amostly conserved

563Tmostly conserved

564Gmostly conserved

565Cmostly conserved

566Tmostly conserved

570Amostly conserved

572Cmostly conserved

573Tmostly conserved

574Gmostly conserved

575Amostly conserved

576Tmostly conserved

594Cvariable

ATTTTTGGAGGTTTTGGAGGAATGATTGGTACTGCCCTTTCAGTTATTATAAGGCTTGAACTATCTAACCCTGGTTCTATGATTGGTGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes29

BINs2

Most divergent pair4.8%

N.AmericaOtherEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S18S-5P28S

animal barcoderibosomalmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aglantha digitale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 457 220 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aglantha digitale1.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type35 991 records

Wild obs. + sensor18 011

Museum / vouchered14 899

Other3 081

Range

Area of Occupancy AOO19 116 km²

Depth

0–200 m sunlit18 608

200–1000 m twilight1 440

1–4 km midnight421

>4 km abyssal63

median 49.8 m · max 10 000 m · 20 532 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 226≤1 km 77≤10 km 15>10 km 44

362 georeferenced · 17 649 without coordinates

Open the mapobservation + sensor18 011

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 1 627≤1 km 10≤10 km 11>10 km 3

1 651 georeferenced · 13 248 without coordinates

Open the institutions mapphysical evidence14 899

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ArcODlocation not on record	3 238
Washington, US	181
730location not on record	70
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	27
CASlocation not on record	20
The Atlantic reference Centrelocation not on record	15
JODClocation not on record	14
Maurice Lamontagne Institutelocation not on record	14
DASSHlocation not on record	14
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	13
Centre for Biodiversity Genomicslocation not on record	12
The Atlantic Reference Centre (ARC)location not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
BioPlatformslocation not on record	3
Victoria, CA	2
Gothenburg, SE	2
Citadel Hill, GB	2
Cambridge, US	2
University Museum of Bergen, Natural History Collectionslocation not on record	2
South Kensington, GB	2
	1
Edmonton, CA	1
Toronto, CA	1
PNHSlocation not on record	1

25 institutions · 3 649 of 14 899 vouchered records shown · 3 564 without an institution code

09Environmental DNA2 919 detections

Where the DNA of Aglantha digitale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 919

Studies independent surveys9

Countries15

Verifiable raw sequence linked722

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 919 detections have coordinates

Open the map15 countries0

water columnMarinePlanktonicMarine; pelagicPacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.3 °C 0–31.9

pH8.29 7.66–8.91

Conductivity48,653 µS/cm 30,290–60,946

Salinity35.5 PSU 23.8–38.7

Dissolved oxygen7.18 mg/L 2.18–11.7

Turbidity0.264 NTU 0–73.0

Nitrate1.20 µmol/L 0.009–14.2

Depth25.0 m 0–5,640

PelagicCoastal water

1 828 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 4.50–24.1

Seasonal swing summer↔winter7.10 °C

Max temp (day)18.2 °C 7.20–24.7

Min temp (night)15.8 °C 1.20–23.1

Precipitation90.6 mm/mo 30.7–154

Air humidity60.0 % 56.4–66.2

Vapour deficit778 Pa 310–1,206

Cloud cover30.0 % 16.5–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 905 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglantha digitale

At a glance

Sources11 archives

Habitat & environment1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type35 991 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type35 991 records