Aglaja ocelligera

(Bergh, 1894) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Cephalaspidea/Aglajidae/Aglaja

At a glance

Occurrence records344

Data sources7

Biological traits4

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Aglaja ocelligera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility294 records↗

OBISOcean Biodiversity Information System50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS344 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aglaja ocelligera is een slakkensoort uit de familie van de Aglajidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1893 door Bergh.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglaja ocelligera has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

112Tmostly conserved

136Tmostly conserved

157Cmostly conserved

166Amostly conserved

247Cmostly conserved

250Tvariable

283Tvariable

340Cmostly conserved

355Amostly conserved

376Tmostly conserved

400Cmostly conserved

481Tmostly conserved

533Cvariable

AACGTTATATATAATCTTTGGTATATGATGTGGGCTAGTAGGTACAGGGCTTAGACTACTTATTCGGTTTGAGTTAGGTACCGCTTCCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Navanax nyanyanussame family17.3%Philinopsis pusasame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type344 records

Wild obs. + sensor261

Museum / vouchered82

Other1

Range

Area of Occupancy AOO616 km²

Depth

0–200 m sunlit19

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 46 m · max 914.4 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 117≤1 km 77≤10 km 16>10 km 12

222 georeferenced · 39 without coordinates

Open the mapobservation + sensor261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 6≤10 km 34>10 km 9

49 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	25
Victoria, CA	11
Santa Barbara Museum of Natural Historylocation not on record	10
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Florida Museum of Natural Historylocation not on record	1
Los Angeles, US	1
Washington, US	1

7 institutions · 52 of 82 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Aglaja ocelligera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

intertidal cobble and bedrocksandy beachseagrass bed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 12.7–14.4

Seasonal swing summer↔winter11.9 °C

Max temp (day)17.1 °C 16.5–17.6

Min temp (night)10.4 °C 8.20–12.4

Precipitation130 mm/mo 93.0–200

Air humidity66.1 % 61.2–69.4

Moisture balance21.9 mm/mo -24.3–94.8

Vapour deficit517 Pa 501–574

Wind speed4.00 m/s 2.50–4.30

Cloud cover38.4 % 37.0–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)