Agelastica coerulea

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Agelastica

At a glance

Occurrence records1 079

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Agelastica coerulea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 079 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 079 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Agelastica coerulea is een keversoort uit de familie bladkevers (Chrysomelidae). De wetenschappelijke naam van de soort werd in 1860 gepubliceerd door Joseph Sugar Baly.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelastica coerulea has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

22Tmostly conserved

99Amostly conserved

189Tmostly conserved

360Gmostly conserved

363Tmostly conserved

513Avariable

576Avariable

GCAGGAATAGTAGGAACCTCATTAAGAATTCTGATTCGAGTAGAATTAGGAAATCCAGGTTCATTAATTGGTAATGACCAAATTTACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes4

BIN1

Most divergent pair0.80%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelastica alnisame genus8.3%Cyclophora obstatariasame order15.1%Xylopteryx oneilisame order15.5%Lomaspilis opissame order15.5%Bastilla absentimaculasame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agelastica coerulea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type1 079 records

Wild obs. + sensor874

Museum / vouchered205

Range

Area of Occupancy AOO2 884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 74≤1 km 31≤10 km 27>10 km 23

155 georeferenced · 719 without coordinates

Open the mapobservation + sensor874

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 4≤10 km 13

17 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	44
HUNMlocation not on record	25
DRIBlocation not on record	23
Nagatoro-machi, Chichibu-gun, JP	19
Obihiro Centennial City Museumlocation not on record	16
Sanda, JP	14
Tartu, EE	13
National Institute of Biological Resourceslocation not on record	10
Chiba, JP	8
Sagamihara, JP	6
KNAMlocation not on record	5
Tomioka, JP	4
Department of Microbiology, Prince of Songkla Universitylocation not on record	4
Yamaguchi-shi, JP	3
Bando, JP	3
MJINlocation not on record	2
Iwate Prefectural Museumlocation not on record	1
Toyota city nature sanctuarylocation not on record	1
Tokushima, JP	1

19 institutions · 202 of 205 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Agelastica coerulea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agelastica coerulea

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 079 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 079 records