Agdistis tamaricis

(Zeller, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Agdistis

At a glance

Occurrence records94

Data sources8

Biological traits0

DNA specimens19

eDNA detections10

Sources8 archives

Databases and archives Agdistis tamaricis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD19 specimens

01Narrative

Agdistis tamaricis (tamarisk plume) is a moth of the family Pterophoridae found in Africa, Asia and Europe. It was first described by the German entomologist, Philipp Christoph Zeller in 1847.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agdistis tamaricis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs5

Marker genes1

eDNA detections10

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

4Amostly conserved

22Amostly conserved

31Amostly conserved

38Cvariable

49Tmostly conserved

58Amostly conserved

67Tmostly conserved

74Tvariable

79Amostly conserved

100Tmostly conserved

103Tmostly conserved

115Tmostly conserved

142Tmostly conserved

157Tmostly conserved

193Tmostly conserved

197Tmostly conserved

205Amostly conserved

206Cvariable

214Amostly conserved

220Cvariable

235Cmostly conserved

238Cmostly conserved

250Tmostly conserved

271Cmostly conserved

281Cmostly conserved

283Amostly conserved

287Cmostly conserved

295Amostly conserved

313Tmostly conserved

322Amostly conserved

340Cmostly conserved

346Tmostly conserved

352Cvariable

355Amostly conserved

359Tvariable

364Cmostly conserved

367Tmostly conserved

379Tvariable

382Tmostly conserved

386Cvariable

391Tmostly conserved

397Tmostly conserved

399Cmostly conserved

400Cvariable

403Tmostly conserved

424Amostly conserved

433Tmostly conserved

436Tvariable

442Tmostly conserved

445Tvariable

469Amostly conserved

470Cmostly conserved

472Tmostly conserved

475Tmostly conserved

487Tmostly conserved

499Tvariable

502Avariable

505Cmostly conserved

508Cvariable

517Amostly conserved

520Tmostly conserved

526Amostly conserved

530Gmostly conserved

533Tmostly conserved

535Amostly conserved

536Cvariable

539Cmostly conserved

541Tmostly conserved

548Tmostly conserved

562Avariable

568Amostly conserved

577Amostly conserved

586Tvariable

589Tvariable

592Amostly conserved

596Tvariable

601Tmostly conserved

604Cvariable

613Cvariable

616Cvariable

619Amostly conserved

622Amostly conserved

625Amostly conserved

628Amostly conserved

631Amostly conserved

637Amostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATACTAGGAACTTCTTTAAGTATATTAATTCGTGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes10

BINs5

Most divergent pair8.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agdistis americanasame genus8.8%Agdistis nanodessame genus9.6%Drasteria langisame order10.4%Dichromodes triparatasame order10.6%Agdistis tsumkwesame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor82

Museum / vouchered11

Other1

Origin

Native2

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 24≤1 km 17≤10 km 11>10 km 7

59 georeferenced · 23 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Naturalis Biodiversity Centerlocation not on record	1
Provincia di Livornolocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

3 institutions · 3 of 11 vouchered records shown · 8 without an institution code

09Environmental DNA10 detections

Where the DNA of Agdistis tamaricis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

forest edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 12.4–24.0

Seasonal swing summer↔winter16.7 °C

Max temp (day)21.1 °C 14.6–26.7

Min temp (night)17.2 °C 9.60–20.5

Precipitation27.7 mm/mo 9.30–103

Air humidity59.0 % 57.6–63.2

Moisture balance-81.9 mm/mo

Vapour deficit864 Pa 599–1,257

Wind speed3.60 m/s

Cloud cover38.4 % 29.6–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)