Agathymus remingtoni

(Stallings & Turner, 1958) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Agathymus

At a glance

Occurrence records73

Data sources7

Biological traits0

DNA specimens24

eDNA detections24

Sources7 archives

Databases and archives Agathymus remingtoni's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF73 records

Environmental DNA1 datasets · 0 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Agathymus remingtoni, the coahuila giant skipper, is a species of giant skipper in the butterfly family Hesperiidae. It is found in Central America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathymus remingtoni has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections24

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P678 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AAGATATTGGTACTTTATATTTTATTTTTGGTATTTGAGCAGGTATACTAGGAACATCTTTAAGATTATTAATTCGTACAGAATTAGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes3

BIN1

Most divergent pair0.29%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathymus evansisame genus5.8%Megathymus cofaquisame family6.5%Agathymus aryxnasame genus6.7%Agathymus bauerisame genus7.3%Cynea cyneasame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type73 records

Wild obs. + sensor1

Museum / vouchered71

Other1

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 3≤10 km 60

63 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence71

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	56
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
FLMNH-UFlocation not on record	6
Mexico City, MX	1

4 institutions · 71 of 71 vouchered records shown

09Environmental DNA24 detections

Where the DNA of Agathymus remingtoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)