Agathotoma candidissima

(C.B.Adams, 1845) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Mangeliidae/Agathotoma

At a glance

Occurrence records493

Data sources6

Biological traits5

DNA specimens19

eDNA detections0

Sources6 archives

Databases and archives Agathotoma candidissima's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility310 records↗

OBISOcean Biodiversity Information System183 records↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS493 records

DNA & barcodingBOLD19 specimens

01Narrative

+ Agathotoma candidissima, common name Cox's mangelia, is a species of sea snail, a marine gastropod mollusc in the family Mangeliidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max103 m

Depth min0 m

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathotoma candidissima has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

187Tvariable

214Gvariable

271Cmostly conserved

277Cmostly conserved

313Avariable

319Amostly conserved

352Gvariable

355Gmostly conserved

386Tmostly conserved

499Tmostly conserved

502Gvariable

532Tmostly conserved

547Tvariable

604Tmostly conserved

613Tvariable

652Cmostly conserved

TACATTATACATTTTATTTGGGATGTGATCAGGATTAGTGGGTACTGCACTTAGTCTATTAATCCGAGCAGAGCTAGGTCAACCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes7

BIN1

Most divergent pair1.7%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathotoma prominenssame genus10.2%Agathotoma asthenikasame genus10.6%Agathotoma castellatasame genus12.9%Kurtziella venezuelanasame family14.7%Trachypollia lugubrissame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S12S28SH3

animal barcoderibosomalmarker

08Occurrence & distribution

Record type493 records

Wild obs. + sensor38

Museum / vouchered446

Fossil9

Range

Area of Occupancy AOO772 km²

Depth

0–200 m sunlit121

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 37 m · max 180 m · 121 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 8

10 georeferenced · 28 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 4≤1 km 8≤10 km 1>10 km 7

20 georeferenced · 426 without coordinates

Open the institutions mapphysical evidence446

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	77
Philadelphia, US	57
Delaware Museum of Nature and Sciencelocation not on record	16
Washington, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Denver, US	3
Cambridge, US	2
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	1
CIM-UHlocation not on record	1
Chongqing Museumlocation not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1

13 institutions · 173 of 446 vouchered records shown · 118 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)