Agathis dammara

(Lamb.) Rich. & A.Rich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Araucariaceae/Agathis

At a glance

Occurrence records138

Data sources13

Biological traits21

DNA specimens10

eDNA detections8

Sources13 archives

Databases and archives Agathis dammara's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility138 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF138 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceGoaT13.2 Gbp

01Narrative

Agathis dammara, commonly known as the Amboina pine or dammar pine, is a coniferous timberAgathis wood tree native to Sulawesi, the Maluku Islands and the Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height50 m

⚠ sources differ — GIFT: 50 m · TRY: 38 m

Seed mass122 mg

Seed mass max135 mg

Seed mass min109 mg

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density432 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition19 compounds

Compounds documented for Agathis dammara across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones6

Germacrane sesquiterpenoids2

Flavanones2

Aromadendrane sesquiterpenoids2

Phytane diterpenoids1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(1aS,4aR,7S,7aR,7bR)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulene	present	NPASS
(1S,3aR,5aS,5bR,7aR,9S,11aR,11bR,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-propan-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13b-tetradecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
(R)-Isosakuranetin	present	NPASS
(R)-naringenin	present	NPASS
5,7-Dihydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-6-yl]-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS
5,7-Dihydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-6-yl]-2-(4-methoxyphenyl)chromen-4-one	present	LOTUS
5,7-Dihydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-8-yl]-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS
5-Hydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-8-yl]-2-(4-hydroxyphenyl)-7-methoxychromen-4-one	present	LOTUS
[(3aR,4R,5E,8R,9E,11aS)-4-acetyloxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,7,8,11,11a-hexahydrocyclodeca[b]furan-8-yl] acetate	present	NPASS
[(3aR,4R,6E,8S,10E,11aR)-4-hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-8-yl] acetate	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathis dammara has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences9

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN564953.1 ↗1 393 bp

ACGT

TCGTGCCTGGCGAACCGTGAAGGGGAGGGAAGGATTCTTCGACGCGTCCGCACGAAACCACCCCCCGGGACGAAACTCCTGTGTGGGGGG …

Agathis dammara strain 255 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL5★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Agathis dammara carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 227 450 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Agathis dammara13.23 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type138 records

Wild obs. + sensor1

Museum / vouchered132

Cultivated / captive2

Fossil1

Other2

Origin

Introduced1

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 3≤10 km 4>10 km 1

8 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence132

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	4
Bronx, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
South Kensington, GB	3
Beijing, CN	2
Fort Worth, US	2
CJBGlocation not on record	1
Durban, ZA	1
Philadelphia, US	1
Auckland, NZ	1
Severin-McDaniel Insect Collectionlocation not on record	1
University of Stellenboschlocation not on record	1
TAIElocation not on record	1
Honolulu, US	1
University of Santo Tomas Herbariumlocation not on record	1
Chongqing Museumlocation not on record	1
WAGlocation not on record	1

17 institutions · 28 of 132 vouchered records shown · 104 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Agathis dammara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)