Agathidium nigrinum

Sturm, 1807 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Leiodidae/Agathidium

At a glance

Occurrence records865

Data sources5

Biological traits0

DNA specimens7

eDNA detections8

Sources5 archives

Databases and archives Agathidium nigrinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility865 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF865 records

Environmental DNA2 datasets · 4 countries8 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathidium nigrinum has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

4Cvariable

34Gvariable

181Avariable

202Cvariable

217Avariable

271Tvariable

379Amostly conserved

400Avariable

433Avariable

514Avariable

523Tmostly conserved

548Tmostly conserved

571Tmostly conserved

622Tvariable

625Cvariable

AACCTTATATTTTATTTTTGGCGCTTGATCTGGGATAGTTGGCACTTCTCTTAGAATTTTAATTCGAGCTGAATTAGGAACTCCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathidium arcticumsame genus10.0%Agathidium angularesame genus10.0%Agathidium nigripennesame genus11.7%Agathidium pulchrumsame genus12.3%Anisotoma obsoletasame family12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type865 records

Wild obs. + sensor460

Museum / vouchered398

Fossil3

Other4

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 229≤1 km 104≤10 km 98

431 georeferenced · 29 without coordinates

Open the mapobservation + sensor460

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 118≤1 km 154≤10 km 82>10 km 5

359 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence398

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	197
Helsinki, FI	57
Metsähallituslocation not on record	19
Trondheim, NO	18
NHMOlocation not on record	16
NTNU-VMlocation not on record	12
Bonn, DE	11
Olocation not on record	11
ZSMlocation not on record	7
MZLUlocation not on record	5
BioFokuslocation not on record	4
CBDClocation not on record	4
LSMlocation not on record	4
Jyväskylä, FI	3
Tromsø, NO	2
Copenhagen, DK	2
NMBU:MINAlocation not on record	2
Salzburg, AT	1
IFR-DNFlocation not on record	1
Tartu, EE	1
Uniwersytet Wrocławskilocation not on record	1
Vitoria, ES	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
NCMGlocation not on record	1
ZMAAlocation not on record	1

26 institutions · 383 of 398 vouchered records shown · 15 without an institution code

09Environmental DNA8 detections

Where the DNA of Agathidium nigrinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

aus trockenen losen Rinden einer toten Kiefe…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 7.10–11.5

Seasonal swing summer↔winter17.5 °C

Max temp (day)14.0 °C 10.2–15.2

Min temp (night)7.50 °C 4.40–8.50

Precipitation72.3 mm/mo 57.2–82.5

Air humidity65.8 % 64.5–67.5

Moisture balance20.6 mm/mo 12.9–42.9

Vapour deficit432 Pa 339–487

Wind speed3.20 m/s 2.80–5.00

Cloud cover44.9 % 43.4–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)