Agathia lycaenaria

(Kollar, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Agathia

At a glance

Occurrence records255

Data sources6

Biological traits0

DNA specimens34

eDNA detections13

Sources6 archives

Databases and archives Agathia lycaenaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility255 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF255 records

Environmental DNA1 datasets · 5 countries13 detections

DNA & barcodingBOLD34 specimens

01Narrative

Agathia lycaenaria is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1844 door Kollar.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathia lycaenaria has left across the world's sequence archives.

At a glance

DNA specimens34

BINs5

Marker genes1

eDNA detections13

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

5Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Tmostly conserved

10Tmostly conserved

12Tmostly conserved

13Gmostly conserved

15Tmostly conserved

16Amostly conserved

17Tmostly conserved

20Gmostly conserved

21Amostly conserved

22Gmostly conserved

23Cmostly conserved

24Amostly conserved

25Gmostly conserved

27Amostly conserved

31Amostly conserved

39Cvariable

60Amostly conserved

99Cvariable

114Amostly conserved

165Cvariable

210Gmostly conserved

213Cvariable

228Cvariable

259Cvariable

264Amostly conserved

270Cvariable

273Tvariable

277Tmostly conserved

309Amostly conserved

342Gvariable

363Amostly conserved

384Tmostly conserved

387Tmostly conserved

405Avariable

408Tmostly conserved

426Gvariable

435Cvariable

498Cvariable

499Avariable

522Cvariable

525Tmostly conserved

532Cvariable

540Avariable

558Tvariable

576Gvariable

588Tmostly conserved

609Tmostly conserved

615Tmostly conserved

627Tmostly conserved

634Cmostly conserved

TATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes7

BINs4

Most divergent pair6.9%

AsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathia gemmasame genus3.9%Agathia carasame genus4.0%Agathia pisinasame genus4.5%Agathia distributasame genus4.5%Agathia largitasame genus5.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type255 records

Wild obs. + sensor229

Museum / vouchered26

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 75≤1 km 58≤10 km 18>10 km 24

175 georeferenced · 54 without coordinates

Open the mapobservation + sensor229

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
FACTlocation not on record	8
Taiwan Forestry Research Institutelocation not on record	8
ZSMlocation not on record	2
Australian National Insect Collectionlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
ZSM Collection of Manfred Sommererlocation not on record	1

6 institutions · 22 of 26 vouchered records shown · 4 without an institution code

09Environmental DNA13 detections

Where the DNA of Agathia lycaenaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 17.2–27.6

Seasonal swing summer↔winter2.00 °C

Max temp (day)26.0 °C 22.7–30.2

Min temp (night)20.2 °C 11.8–25.4

Precipitation192 mm/mo 35.6–228

Air humidity65.9 % 50.2–70.1

Moisture balance57.2 mm/mo

Vapour deficit1,002 Pa 837–1,282

Wind speed1.90 m/s

Cloud cover46.3 % 30.4–67.4

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)