Agathia carissima

Butler, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Agathia

At a glance

Occurrence records263

Data sources7

Biological traits0

DNA specimens8

eDNA detections0

Sources7 archives

Databases and archives Agathia carissima's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF263 records

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT2n = 62

01Narrative

Agathia carissima is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1878 door Butler.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathia carissima has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P681 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes1

BIN1

Where individuals differ — all 30 variable positions, in barcode order

3Amostly conserved

4Tmostly conserved

5Amostly conserved

10Amostly conserved

12Tmostly conserved

16Gmostly conserved

18Tmostly conserved

19Amostly conserved

20Tmostly conserved

23Gmostly conserved

24Amostly conserved

25Gmostly conserved

26Cmostly conserved

27Amostly conserved

28Gmostly conserved

30Amostly conserved

77Amostly conserved

429Gmostly conserved

501Cmostly conserved

666Avariable

669Cvariable

671Cvariable

672Cvariable

673Gmostly conserved

676Gmostly conserved

677Tmostly conserved

678Avariable

679Tmostly conserved

680Amostly conserved

681Avariable

TTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathia gemmasame genus3.8%Agathia carasame genus4.0%Agathia pisinasame genus4.4%Agathia distributasame genus4.4%Agathia largitasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Agathia carissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 311×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 621×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type263 records

Wild obs. + sensor244

Museum / vouchered19

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 69≤1 km 30≤10 km 12>10 km 18

129 georeferenced · 115 without coordinates

Open the mapobservation + sensor244

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 6

7 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	6
National Institute of Biological Resourceslocation not on record	2
KNAMlocation not on record	2
HUNMlocation not on record	2
Hiwa Museum of Natural Historylocation not on record	1
ZSMlocation not on record	1
Chiba, JP	1
KOMlocation not on record	1
Toyota city nature sanctuarylocation not on record	1
Kawasaki Shi Tama Ku, JP	1
KCMNlocation not on record	1

11 institutions · 19 of 19 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)