Agaricus sylvaticus

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records8 722

Data sources10

Biological traits0

DNA specimens4

eDNA detections231

Sources10 archives

Databases and archives Agaricus sylvaticus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 722 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI231 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS116 compounds

Occurrence & distributionGBIF8 722 records

Environmental DNA9 datasets · 18 countries231 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Agaricus silvaticus, l'agaric des forêts, est un champignon agaricomycète du genre Agaricus et de la famille des Agaricaceae. Synonyme : - Psalliota silvatica

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition116 compounds

Compounds documented for Agaricus sylvaticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Unsaturated fatty acids10

Simple aromatic polyketides9

Hydrocarbons9

Drimane sesquiterpenoids8

Pimarane and Isopimarane diterpenoids6

Documented compounds116 total

Compound	Amount	Source
(1R,3R)-spiro[2,3-dihydro-1H-naphthalene-4,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-1,3,8-triol	present	NPASS
(1R,4R)-1-oxodithiolan-4-ol	present	NPASS
(1R,4R,5R,9S,10S,13S)-13-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4R,5R,9S,10S,13S)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-13-ol	present	NPASS
(1R,4S)-1-oxodithiolan-4-ol	present	NPASS
(1R,4S,5R,9S,10R,13S)-13-(hydroxymethyl)-5,9-dimethyl-14-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4S,5R,9S,10R,13S)-13-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4S,5R,9S,10R,13S)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-13-ol	present	NPASS
(1S)-1-[(2R)-7-(hydroxymethyl)-2-(2-hydroxypropan-2-yl)-2,3-dihydro-1-benzofuran-6-yl]propan-1-ol	present	NPASS
(1S)-1-[(2S,4aR,4bR,5R,8aR)-5-hydroxy-2,4b,8,8-tetramethyl-4,4a,5,6,7,8a,9,10-octahydro-3H-phenanthren-2-yl]ethane-1,2-diol	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus sylvaticus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections231

Countries18

The DNA barcodea real sequence read deposited for this species

ITSPZ271285.1 ↗298 bpUSA · 1955

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCTTATACTTTGTTGTAGAAGA …

Agaricus silvaticus isolate MICH CIB voucher MICH:197395 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type8 722 records

Wild obs. + sensor8 145

Museum / vouchered455

Cultivated / captive1

Other121

Origin

Native57

Introduced1

Range

Area of Occupancy AOO18 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 2 103≤1 km 1 274≤10 km 3 855>10 km 19

7 251 georeferenced · 894 without coordinates

Open the mapobservation + sensor8 145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 81≤1 km 129≤10 km 56>10 km 5

271 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence455

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 56 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	38
San Sebastián, ES	29
TROMlocation not on record	27
Kyiv, UA	18
BDBClocation not on record	18
Helsinki, FI	17
WU-MYClocation not on record	17
Auckland, NZ	13
SLU Artdatabankenlocation not on record	10
Vitoria, ES	9
Trondheim, NO	8
Kew, GB	7
Oulu, FI	7
nsnflocation not on record	6
Museo Entomologico de Leonlocation not on record	6
Salzburg, AT	6
Philadelphia, US	6
Karlsruhe, DE	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
Copenhagen, DK	4
Toronto, CA	4
JA-CAGPDS-CAMlocation not on record	4
TUR-Alocation not on record	4
V. N. Karazin National Universitylocation not on record	4
Adelaide, AU	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
CJBGlocation not on record	3
Hobart, AU	3
Kensington, AU	3
University of Oslo, Natural History Museumlocation not on record	2
IB FRC Komi SC UB RASlocation not on record	2
Ann Arbor, US	2
Bronx, US	2
NAlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Turku, FI	2
Chicago, US	2
Tilburg, NL	2
Zürich, CH	1
Uppsala, SE	1
University of the Basque Country (UPV/EHU)location not on record	1
Tromso University Museumlocation not on record	1
DPIlocation not on record	1
National Museums of Kenyalocation not on record	1
Staten Island, US	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Gijón, ES	1
Odawara, JP	1
Pullman, US	1
MAlocation not on record	1
Bardejov, SK	1
Masindi, UG	1
Tartu, EE	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

56 institutions · 323 of 455 vouchered records shown · 132 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA231 detections

Where the DNA of Agaricus sylvaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found231

Studies independent surveys9

Countries18

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 231 detections have coordinates

Open the map18 countries0

PalearcticAfrotropicOceania

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.90 4.30–6.90

Conductivity69.5 µS/cm 16.0–206

Organic carbon2.42 % 0.49–4.55

Water content7.57 % 1.68–34.1

Nitrate-N9.00 mg/kg 0.5–43.0

Phosphorus22.0 mg/kg 2.00–193

Clay12.8 % 5.12–46.9

Sand72.0 % 17.8–92.3

Depth0 m 0–0.2

SoilKurosolTenosolSodosolKandosolChromosolsDermosol

30 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 9.20–16.5

Seasonal swing summer↔winter20.1 °C

Max temp (day)15.6 °C 13.3–19.8

Min temp (night)8.90 °C 5.50–12.1

Precipitation70.1 mm/mo 45.6–117

Air humidity61.7 % 56.4–64.4

Moisture balance6.00 mm/mo -76.6–53.3

Vapour deficit549 Pa 430–806

Wind speed3.00 m/s 2.40–4.90

Cloud cover41.3 % 26.2–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 224 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds116 total

At a glance

Record type8 722 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions30 of 56 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type8 722 records