Agaricus moelleri

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records2 376

Data sources10

Biological traits0

DNA specimens14

eDNA detections12

Sources10 archives

Databases and archives Agaricus moelleri's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF2 376 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Agaricus moelleri, also known as the inky mushroom, or dark scaled mushroom, is a large mushroom of the genus Agaricus. It appears occasionally in most kinds of woodland, during late summer, in northern temperate zones.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Agaricus moelleri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Compound	Class	Amount	Source
Phenol		present	LOTUS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus moelleri has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes3

GenBank sequences10

eDNA detections12

Countries5

The DNA barcodea real sequence read deposited for this species

ITSLC800826.1 ↗363 bpJapan · 2022

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTAGGAGCATGTGCACG …

Agaricus moelleri SBK220722_01 genes for 18S ribosomal RNA, internal transcribed spacer 1 and 5.8S ribosomal RNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10ITS1ITS2

fungal barcode

08Occurrence & distribution

Record type2 376 records

Wild obs. + sensor2 134

Museum / vouchered213

Other29

Origin

Native38

Introduced2

Range

Area of Occupancy AOO4 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 374≤1 km 272≤10 km 1 210>10 km 34

1 890 georeferenced · 244 without coordinates

Open the mapobservation + sensor2 134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 18≤1 km 32≤10 km 6>10 km 1

57 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	20
Copenhagen, DK	15
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	15
Karlsruhe, DE	13
BDBClocation not on record	11
San Sebastián, ES	10
SLU Artdatabankenlocation not on record	6
WU-MYClocation not on record	6
Museo Entomologico de Leonlocation not on record	4
Tomioka, JP	4
Brisbane, AU	4
Departamento de Sistematica e Ecologialocation not on record	3
Helsinki, FI	3
Göteborg, SE	2
Gujarat Biodiversity Gene Banklocation not on record	2
Staten Island, US	2
Chicago, US	2
JA-CAGPDS-CAMlocation not on record	2
Mérida, ES	1
Mexico City, MX	1
TUR-Alocation not on record	1
Toronto, CA	1
Toyota city nature sanctuarylocation not on record	1
Kathmandu, NP	1
Davis and Elkins Collegelocation not on record	1
Philadelphia, US	1
University of the Basque Country (UPV/EHU)location not on record	1
TFC Miclocation not on record	1
Olocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Kyiv, UA	1
Santa Cruz, US	1
LDlocation not on record	1
Gijón, ES	1
Bando, JP	1
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	1
Uppsala, SE	1
Odawara, JP	1
Stockholm, SE	1

39 institutions · 145 of 213 vouchered records shown · 67 without an institution code

09Environmental DNA12 detections

Where the DNA of Agaricus moelleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.7 °C 14.1–28.8

Seasonal swing summer↔winter13.7 °C

Max temp (day)32.2 °C 18.7–32.2

Min temp (night)24.4 °C 8.70–24.4

Precipitation130 mm/mo 77.6–186

Air humidity60.4 % 55.0–64.7

Moisture balance-20.2 mm/mo -59.3–66.0

Vapour deficit1,572 Pa 685–1,574

Wind speed2.50 m/s 2.20–3.10

Cloud cover7.50 % 7.40–27.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources10 archives

Documented compounds1 total

At a glance

Record type2 376 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 376 records