Agaricus lanipes

(F.H.Møller & Jul.Schäff.) Hlaváček · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records278

Data sources7

Biological traits0

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Agaricus lanipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility278 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF278 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Pieczarka krótkotrzonowa – gatunek grzybów z rodziny pieczarkowatych (Agaricaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus lanipes has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences4

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJF797190.1 ↗709 bpFrance · 2004

ACGT

GGATCATTATTGAATTATGTTTCTAGATGGGTTGTAGCTGGCTCTTTAGAGCATGTGCACGCCTGTTTGGACTTCATCTTCATCCACCTG …

Agaricus lanipes voucher CA406 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type278 records

Wild obs. + sensor223

Museum / vouchered51

Other4

Origin

Native22

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 23≤1 km 41≤10 km 148>10 km 6

218 georeferenced · 5 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 2≤1 km 21≤10 km 2

25 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	16
Kew, GB	9
LDlocation not on record	8
SLU Artdatabankenlocation not on record	3
Uppsala, SE	2
BDBClocation not on record	1
Bardejov, SK	1
WU-MYClocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

9 institutions · 42 of 51 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Agaricus lanipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 12.1–12.1

Seasonal swing summer↔winter15.8 °C

Max temp (day)16.2 °C

Min temp (night)8.80 °C

Precipitation88.9 mm/mo

Air humidity63.9 %

Moisture balance22.1 mm/mo

Vapour deficit513 Pa

Wind speed4.70 m/s

Cloud cover42.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)