Agaricus deardorffensis

Kerrigan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records446

Data sources7

Biological traits0

DNA specimens10

eDNA detections11

Sources7 archives

Databases and archives Agaricus deardorffensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility446 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF446 records

Environmental DNA2 datasets · 2 countries11 detections

DNA & barcodingBOLD · NCBI10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus deardorffensis has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ271206.1 ↗298 bpUSA · 1958

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCCTATACTTTGTTGTAAAGGA …

Agaricus deardorffensis isolate MICH CIB C. A. White 602 voucher MICH:199836 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type446 records

Wild obs. + sensor423

Museum / vouchered23

Range

Area of Occupancy AOO1 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 229≤1 km 58≤10 km 18>10 km 30

335 georeferenced · 88 without coordinates

Open the mapobservation + sensor423

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	4
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	3
California State University, East Baylocation not on record	3
National Museums of Kenyalocation not on record	2

4 institutions · 12 of 23 vouchered records shown · 9 without an institution code

09Environmental DNA11 detections

Where the DNA of Agaricus deardorffensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 9.20–14.1

Seasonal swing summer↔winter13.8 °C

Max temp (day)15.6 °C 14.1–19.4

Min temp (night)8.10 °C 4.10–11.6

Precipitation114 mm/mo 71.3–227

Air humidity63.2 % 51.3–66.6

Moisture balance62.2 mm/mo -45.7–180

Vapour deficit495 Pa 446–710

Wind speed2.50 m/s 1.60–3.60

Cloud cover45.9 % 32.4–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)