Agaricus cupreobrunneus

(Jul.Schäff. & Steer) Pilát · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records592

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Agaricus cupreobrunneus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility592 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF592 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Agaricus cupreobrunneus, commonly known as the brown field mushroom, is an edible mushroom of the genus Agaricus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus cupreobrunneus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections9

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMT747201.1 ↗310 bp

ACGT

TGGCTCCCAGGAGCATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTGTTGGGTATGGAGGAAGTG …

Agaricus cupreobrunneus voucher FRI<AUST>:1064 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type592 records

Wild obs. + sensor443

Museum / vouchered148

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO1 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 171≤1 km 66≤10 km 150>10 km 6

393 georeferenced · 50 without coordinates

Open the mapobservation + sensor443

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 20≤1 km 46≤10 km 8>10 km 3

77 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence148

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	21
Olocation not on record	15
Copenhagen, DK	15
SLU Artdatabankenlocation not on record	12
LDlocation not on record	5
Leicester, GB	4
Bernard Price Institute for Palaeontological Researchlocation not on record	4
WU-MYClocation not on record	3
Helsinki, FI	3
Uppsala, SE	3
Kyiv, UA	3
Tilburg, NL	3
Santa Cruz, US	3
Karlsruhe, DE	2
Auckland, NZ	2
University of Oslo, Natural History Museumlocation not on record	2
nsnflocation not on record	2
Göteborg, SE	2
TUR-Alocation not on record	2
BDBClocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
Kew, GB	1
Oulu, FI	1
MAlocation not on record	1

24 institutions · 111 of 148 vouchered records shown · 35 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Agaricus cupreobrunneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

sand, sandstrand med furui gras pÃ¥ rammegrav

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 14.4–17.7

Seasonal swing summer↔winter16.7 °C

Max temp (day)22.4 °C 17.9–22.4

Min temp (night)11.4 °C 10.6–12.9

Precipitation45.3 mm/mo 45.3–89.0

Air humidity51.6 % 51.6–59.9

Moisture balance-83.2 mm/mo -83.2–-16.9

Vapour deficit1,017 Pa 694–1,017

Wind speed3.50 m/s 3.30–4.90

Cloud cover24.0 % 24.0–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)