Agaricus crocodilinus

Murrill · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records1 293

Data sources7

Biological traits0

DNA specimens11

eDNA detections12

Sources7 archives

Databases and archives Agaricus crocodilinus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 293 records

Environmental DNA2 datasets · 3 countries12 detections

DNA & barcodingBOLD · NCBI11 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus crocodilinus has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

GenBank sequences10

eDNA detections12

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ271201.1 ↗305 bpUSA · 1940

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCTTATACTGTTTGGTAAAAGA …

Agaricus crocodilinus isolate MICH CIB P. M. Rea 414 voucher MICH:197091 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 293 records

Wild obs. + sensor1 173

Museum / vouchered118

Other2

Range

Area of Occupancy AOO3 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 284≤1 km 161≤10 km 649>10 km 21

1 115 georeferenced · 58 without coordinates

Open the mapobservation + sensor1 173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 24≤1 km 48≤10 km 16>10 km 2

90 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	32
San Sebastián, ES	15
Trondheim, NO	6
University of Oslo, Natural History Museumlocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	4
WTUlocation not on record	4
Auckland, NZ	3
Bronx, US	3
WU-MYClocation not on record	3
nsnflocation not on record	3
Université de Montréal Biodiversity Centrelocation not on record	3
Denver, US	3
BDBClocation not on record	2
TROMlocation not on record	2
Toronto, CA	2
Davis and Elkins Collegelocation not on record	1
Pullman, US	1
Laramie, US	1
TENN-Flocation not on record	1
Gijón, ES	1
ILLSlocation not on record	1
Personal Herbarium of Potter Palmerlocation not on record	1
Bardejov, SK	1
Staten Island, US	1
Salzburg, AT	1
Research Collection of Jared Urchecklocation not on record	1
Catholic University of Pekinglocation not on record	1

27 institutions · 101 of 118 vouchered records shown · 14 without an institution code

09Environmental DNA12 detections

Where the DNA of Agaricus crocodilinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

Gran, selje, kalk

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 8.20–15.5

Seasonal swing summer↔winter22.2 °C

Max temp (day)15.2 °C 9.70–19.9

Min temp (night)9.20 °C 6.30–10.9

Precipitation91.2 mm/mo 48.8–125

Air humidity59.7 % 55.9–62.7

Moisture balance21.9 mm/mo -52.3–93.2

Vapour deficit569 Pa 412–779

Wind speed3.10 m/s 1.90–4.20

Cloud cover43.3 % 38.0–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agaricus crocodilinus

At a glance

Sources7 archives

At a glance

Record type1 293 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 293 records