Agaricus brunneofibrillosus

Kerrigan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records53

Data sources8

Biological traits0

DNA specimens1

eDNA detections2

Sources8 archives

Databases and archives Agaricus brunneofibrillosus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Agaricus brunneofibrillosus is a mushroom in the family Agaricaceae. It has a medium to dark brown cap up to 6 cm in diameter with brownish fibrillose scales that darken in age. The tightly-packed gills are initially cream colored before becoming pinkish, lilac-gray, and finally brownish as the spores mature. The stout stem is enlarged to bulbous at the base which has one or more brown bands, and a white, membranous ring. The mushroom is edible, and has a pleasant odor similar to button mushrooms, and tastes similar to Agaricus bisporus when cooked.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus brunneofibrillosus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR897878.1 ↗673 bpUSA · 2021

ACGT

GAAGGATCATTATTGAATTATGTTTTCTGGATGGGTTGTAGCTGGCTCTTTGGAGCATGTGCACGCCTGTCCGGACTTCATCTTCATCCA …

Agaricus brunneofibrillosus inaturalist.org/observations/72545579 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor50

Museum / vouchered3

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 10≤1 km 2≤10 km 9>10 km 15

36 georeferenced · 14 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
California State University, East Baylocation not on record	1

1 institutions · 1 of 3 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Agaricus brunneofibrillosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.10 °C 3.10–3.10

Seasonal swing summer↔winter19.2 °C

Max temp (day)9.10 °C

Min temp (night)-2.90 °C

Precipitation63.1 mm/mo

Air humidity52.8 %

Moisture balance-63.6 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover31.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)