Agaricus blazei

Murrill · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records44

Data sources10

Biological traits0

DNA specimens8

eDNA detections8

Sources10 archives

Databases and archives Agaricus blazei's data was compiled from.

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS · NPASS58 compounds

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈39 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition58 compounds

Compounds documented for Agaricus blazei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ergostane steroids28

Unsaturated fatty acids11

Cholestane steroids $ Ergostane steroids3

Purine nucleos(t)ides2

Simple phenolic acids1

Documented compounds58 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3'R,4'S,10R,11R,12S,13R)-5-methoxy-4',5',5',6,10,12-hexamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3'-ol	present	LOTUS
(1R,3'R,4'S,10R,11R,12S,13R)-5-methoxy-4',5',5',6,10,12-hexamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5-triene-13,2'-oxolane]-3'-ol	present	LOTUS
(1R,3'R,4'S,10R,11R,12S,13S)-6-(hydroxymethyl)-4',5',5',10,12-pentamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3',5-diol	present	LOTUS
(1R,3'R,4'S,10S,11R,12S,13R)-4',5',5',6,10,12-hexamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3',5-diol	present	LOTUS
(1R,3'R,4'S,10S,11R,12S,13R)-5-methoxy-4',5',5',6,10,12-hexamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3'-ol	present	LOTUS
(1R,3'R,4'S,10S,11R,12S,13S)-4',5',5',6,10,12-hexamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3',5-diol	present	LOTUS
(1R,3'R,4'S,10S,11R,12S,13S)-4'-(hydroxymethyl)-5-methoxy-5',5',6,10,12-pentamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3'-ol	present	LOTUS
(1R,3'R,4'S,10S,11R,12S,13S)-5-methoxy-4',5',5',6,10,12-hexamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3'-ol	present	LOTUS
(1R,3'R,4'S,10S,11R,12S,13S)-6-(hydroxymethyl)-5-methoxy-4',5',5',10,12-pentamethylspiro[14-oxatetracyclo[9.3.2.01,10.02,7]hexadeca-2(7),3,5,8-tetraene-13,2'-oxolane]-3'-ol	present	LOTUS
(1R,3'R,4'S,10S,14S,15R,16S,17S)-3'-hydroxy-4',5',5',10,14,16-hexamethylspiro[18-oxapentacyclo[13.3.2.01,14.02,11.05,10]icosa-2(11),3,5,12-tetraene-17,2'-oxolane]-7-one	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus blazei has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ010882.1 ↗388 bp

ACGT

TCGAATGTCATTGAATGTCTTTACATGGGCTTGTATGCCTATGAAAATTGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATC …

Agaricus blazei strain U11-5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agaricus blazei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈38 686 133 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Agaricus blazei0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type44 records

Museum / vouchered44

Range

Area of Occupancy AOO52 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 1≤1 km 11≤10 km 19>10 km 4

35 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence44

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FLASlocation not on record	28
Bronx, US	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Catholic University of Pekinglocation not on record	2
TENN-Flocation not on record	1
WTUlocation not on record	1
Clemson, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
McWane Science Centerlocation not on record	1
Champaign, US	1

10 institutions · 43 of 44 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Agaricus blazei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.3 °C 28.1–28.4

Seasonal swing summer↔winter13.8 °C

Max temp (day)30.9 °C 30.6–31.1

Min temp (night)25.1 °C 25.0–25.1

Precipitation249 mm/mo 244–255

Air humidity64.1 % 63.6–64.7

Moisture balance107 mm/mo 101–113

Vapour deficit1,381 Pa 1,347–1,414

Wind speed3.20 m/s 3.20–3.30

Cloud cover22.8 % 22.6–23.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)