Agaricus arorae

Kerrigan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records55

Data sources8

Biological traits0

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Agaricus arorae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF55 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Agaricus arorae is a moderate-sized, forest-dwelling mushroom that exhibits distinctive color changes. It fruits early in the mushroom season. Unusually within the genus Agaricus, the mushroom's cap cuticle turns yellow when exposed to a base such as potassium hydroxide or sodium hydroxide but stains red when cut.Arora, p. 313, p. 326 In the field, it has a brownish, fibrillose/squamulose cap, which turns red when bruised. Agaricus arorae was first described from Santa Cruz County but since has been found in San Mateo and Alameda counties.Kerrigan, Richard W. (1985)Arora, p. 311Studies in Agaricus III. New species from California. Mycotaxon 12: 419-434. Agaricus arorae can be distinguished by its scales and a conspicuous stipe.Kerrigan, Richard W. (1986). The Agaricales (Gilled Fungi) of California. 6. Agaricaceae. Mad River Press: Eureka, CA. 62 p. Agaricus arorae was named after American mycologist and author David Arora.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus arorae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ144005.1 ↗744 bpUSA · 2023

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTCCAGATGGGTTGTAGCTGGCTCCGTGGAGCATG …

Agaricus arorae voucher FDS-CA-00015 bio-material iNAT:192796439 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type55 records

Wild obs. + sensor53

Museum / vouchered2

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 22≤1 km 10≤10 km 7>10 km 5

44 georeferenced · 9 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
California State University, East Baylocation not on record	1
Santa Cruz, US	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Agaricus arorae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C 5.30–13.1

Seasonal swing summer↔winter11.7 °C

Max temp (day)13.0 °C 9.80–16.2

Min temp (night)6.20 °C 1.60–10.8

Precipitation234 mm/mo 91.6–376

Air humidity61.9 % 58.6–65.2

Vapour deficit448 Pa 370–526

Cloud cover42.6 % 37.7–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)