Agaricus amicosus

Kerrigan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Agaricus

At a glance

Occurrence records67

Data sources7

Biological traits0

DNA specimens0

eDNA detections4

Sources7 archives

Databases and archives Agaricus amicosus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA2 datasets · 3 countries4 detections

DNA & barcodingNCBIsequences

01Narrative

Agaricus amicosus is a mushroom in the family Agaricaceae, found in high-elevation forests in the Rocky Mountains, and is particularly common in the Colorado Rockies. It occurs in deep leaf litter under spruce and fir and fruits from late summer to early fall. It is considered a choice edible species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricus amicosus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOP150358.1 ↗296 bpUSA · 1995

ACGT

AACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCTTATACTTTGTTGTAAAGGAG …

Agaricus amicosus voucher DBG:F-018296 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor28

Museum / vouchered39

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 7≤1 km 3≤10 km 9>10 km 4

23 georeferenced · 5 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 1≤10 km 6>10 km 4

14 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	31
Chicago, US	2
TROMlocation not on record	1
nsnflocation not on record	1

4 institutions · 35 of 39 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Agaricus amicosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

NeotropicAustralasia

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 14.2–25.3

Seasonal swing summer↔winter5.00 °C

Max temp (day)28.0 °C 17.5–28.5

Min temp (night)21.0 °C 10.7–22.8

Precipitation105 mm/mo 93.0–113

Air humidity62.6 % 61.5–63.0

Moisture balance-19.9 mm/mo -24.3–11.1

Vapour deficit1,149 Pa 648–1,241

Wind speed1.80 m/s 1.80–1.90

Cloud cover35.0 % 31.5–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)