Agaricochara latissima

(Stephens, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Agaricochara

At a glance

Occurrence records611

Data sources7

Biological traits2

DNA specimens37

eDNA detections27

Sources7 archives

Databases and archives Agaricochara latissima's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility611 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF611 records

Environmental DNA1 datasets · 4 countries27 detections

DNA & barcodingBOLD37 specimens

01Narrative

Agaricochara latissima is a species of beetle belonging to the family Staphylinidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)fungivore

Feeding guild (larval)fungivore

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agaricochara latissima has left across the world's sequence archives.

At a glance

DNA specimens37

BINs3

Marker genes1

eDNA detections27

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

4Amostly conserved

5Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

13Cmostly conserved

14Amostly conserved

15Tmostly conserved

20Gmostly conserved

22Amostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Gmostly conserved

34Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

41Gmostly conserved

43Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

48Cmostly conserved

51Tmostly conserved

52Amostly conserved

54Gmostly conserved

55Amostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

61Amostly conserved

63Tmostly conserved

64Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Cmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

79Amostly conserved

82Cmostly conserved

85Tvariable

100Tmostly conserved

166Avariable

199Avariable

206Cvariable

280Gvariable

337Gvariable

355Cvariable

433Gvariable

499Avariable

500Cvariable

544Gmostly conserved

565Amostly conserved

628Gvariable

AACATTATATTTCATTTTTGGAGCTTGATCGGGAATAGTTGGGACTTCCCTAAGATTATTAATCCGAGCTGAACTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes9

BINs3

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oxypoda hiemalissame family14.3%Parocyusa longitarsissame family14.4%Aleochara curtulasame family14.7%Oxypoda alternanssame family14.9%Acrotona parvulasame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type611 records

Wild obs. + sensor344

Museum / vouchered232

Cultivated / captive9

Other26

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 96≤1 km 111≤10 km 91>10 km 1

299 georeferenced · 45 without coordinates

Open the mapobservation + sensor344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 157≤1 km 34≤10 km 17

208 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence232

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NMBU:MINAlocation not on record	65
SLU Artdatabankenlocation not on record	38
Trondheim, NO	19
Copenhagen, DK	10
ZSMlocation not on record	8
NTNU-VMlocation not on record	7
CBDClocation not on record	7
Salzburg, AT	5
Tilburg, NL	5
Muzeum Górnośląskie w Bytomiulocation not on record	3
NCMGlocation not on record	3
MZLUlocation not on record	3
BioFokuslocation not on record	2
Olocation not on record	2
Tromsø, NO	2
NHMOlocation not on record	1
LSMlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

18 institutions · 182 of 232 vouchered records shown · 50 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA27 detections

Where the DNA of Agaricochara latissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map4 countries0

aus mulmigen verpilzten Rinden einer liegend…LaubwaldUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 4.20–13.6

Seasonal swing summer↔winter15.7 °C

Max temp (day)13.9 °C 6.50–17.7

Min temp (night)7.20 °C 1.40–9.70

Precipitation72.6 mm/mo 55.0–85.0

Air humidity65.3 % 62.6–69.7

Moisture balance36.4 mm/mo -8.10–56.4

Vapour deficit431 Pa 253–585

Wind speed3.70 m/s 2.80–4.90

Cloud cover46.1 % 38.4–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)