Agapetus fuscipes

Curtis, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Glossosomatidae/Agapetus

At a glance

Occurrence records4 316

Data sources8

Biological traits2

DNA specimens105

eDNA detections63

Sources8 archives

Databases and archives Agapetus fuscipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 316 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics105 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 316 records

Environmental DNA1 datasets · 8 countries63 detections

DNA & barcodingBOLD105 specimens

Genome at a glanceGoaT · NCBI≈618 Mbp

01Narrative

Agapetus fuscipes is een schietmot uit de familie Glossosomatidae. De soort komt voor in het Palearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)possible nectivore

Feeding guild (larval)omnivore

05DNA & barcoding105 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapetus fuscipes has left across the world's sequence archives.

At a glance

DNA specimens105

BINs3

Marker genes3

eDNA detections63

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

40Gmostly conserved

59Cmostly conserved

79Gmostly conserved

142Cmostly conserved

184Amostly conserved

205Tmostly conserved

217Gmostly conserved

316Gmostly conserved

346Amostly conserved

466Amostly conserved

518Cmostly conserved

539Cmostly conserved

550Gmostly conserved

586Gmostly conserved

601Tmostly conserved

604Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAAGAGGCATAGTGGGAACTTCTTTAAGAATACTAATTCGAAGAGAATTAGGGACTAACAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes17

BINs3

Most divergent pair8.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapetus nimbulussame genus9.3%Agapetus segovicussame genus9.4%Agapetus caucasicussame genus10.3%Agapetus slavorumsame genus11.7%Agapetus ochripessame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agapetus fuscipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈618 267 425 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agapetus fuscipes0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.8% BUSCO

08Occurrence & distribution

Record type4 316 records

Wild obs. + sensor3 447

Museum / vouchered782

Other87

Origin

Native67

Range

Area of Occupancy AOO6 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 460≤1 km 186≤10 km 529>10 km 2

3 177 georeferenced · 270 without coordinates

Open the mapobservation + sensor3 447

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 212≤1 km 157≤10 km 233>10 km 1

603 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence782

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	119
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	90
Provincia di Livornolocation not on record	81
UMUlocation not on record	48
UGRlocation not on record	41
MZLUlocation not on record	37
South Kensington, GB	29
University of Kaiserslauternlocation not on record	29
Natural History Museum, Londonlocation not on record	22
Institute of Zoology Slovak Academy of Scienceslocation not on record	20
AQBGlocation not on record	14
Frankfurt am Main	13
Zürich, CH	10
St. Paul, US	7
Champaign, US	5
CIBIOlocation not on record	4
Stockholm, SE	4
Musee cantonal de zoologie de Lausannelocation not on record	3
SLU Artdatabankenlocation not on record	2
NCMGlocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Ulster Museumlocation not on record	1
Montréal, CA	1
ZSMlocation not on record	1
Wellcome Sanger Institutelocation not on record	1

25 institutions · 586 of 782 vouchered records shown · 196 without an institution code

09Environmental DNA63 detections

Where the DNA of Agapetus fuscipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 11.8–17.2

Seasonal swing summer↔winter16.8 °C

Max temp (day)18.4 °C 14.4–21.2

Min temp (night)10.8 °C 7.80–12.0

Precipitation75.4 mm/mo 53.7–123

Air humidity60.6 % 58.3–63.4

Moisture balance-40.5 mm/mo -64.1–29.3

Vapour deficit644 Pa 469–763

Wind speed3.90 m/s 1.90–4.90

Cloud cover36.1 % 33.1–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agapetus fuscipes

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 316 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 316 records