Agapeta hamana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Agapeta

At a glance

Occurrence records39 607

Data sources10

Biological traits2

DNA specimens92

eDNA detections211

Sources10 archives

Databases and archives Agapeta hamana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 607 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI211 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF39 607 records

Environmental DNA3 datasets · 16 countries211 detections

DNA & barcodingBOLD92 specimens

Genome at a glanceGoaT · NCBI≈666 Mbp

01Narrative

Agapeta hamana is a moth of the family Tortricidae. It is found in Europe (from the Iberian Peninsula to the Ural Mountains), western and southern Siberia, the Caucasus, Kazakhstan, Transcaucasia, Asia Minor, Central Asia, Iran, Afghanistan, Mongolia, western China and northern India., 2010: Clepsis trifasciata sp. n. with notes on some Lepidoptera Tortricidae from Kirgizstan. Journal of Entomological and Acarological Research Serie II 42 (1): 1-10. Abstract and full article: [1] The wingspan is 15–25 mm.The pale yellow forewing has the costa moderately arched. The base of the costa, and a streak from the disc to beyond the middle of the tornus are ferruginous-fuscous. Sometimes there are several irregular variable ferruginous marks towards the margins. The hindwings are rather dark grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and descriptionJulius von Kennel provides a full description. Julius von Kennel, 1921, The Palaearktischen Tortriciden, eine monographische Darstellung. Stuttgart: E. Schweizerbart'sche Verlagsbuchhandlung. 742 pp. - Palaearctic Tortricidae, a monograph.pdf at Zobodat 322-323 The moth flies from June to August, from dusk. The larvae feed on Carduus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapeta hamana has left across the world's sequence archives.

At a glance

DNA specimens92

BINs1

Marker genes1

eDNA detections211

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus89 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

628Gmostly conserved

631Amostly conserved

AACATTATATTTTATTTTTGGTATTTGATCAGGTATATTAGGAACTTCTTTAAGTATATTAATCCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes12

BIN1

Most divergent pair0.61%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Fulvoclysia palloranasame family7.4%Agapeta zoeganasame genus7.4%Cochylimorpha alternanasame family8.2%Cochylimorpha hilaranasame family8.7%Phtheochroa canarianasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agapeta hamana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈666 239 130 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agapeta hamana0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type39 607 records

Wild obs. + sensor37 909

Museum / vouchered1 582

Other116

Origin

Native164

Range

Area of Occupancy AOO41 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 13 092≤1 km 3 646≤10 km 16 991>10 km 156

33 885 georeferenced · 4 024 without coordinates

Open the mapobservation + sensor37 909

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 899≤1 km 276≤10 km 161

1 336 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence1 582

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	942
Provincia di Livornolocation not on record	156
NHMOlocation not on record	58
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	55
Tartu, EE	55
SLU Artdatabankenlocation not on record	32
Nijmegen, NL	31
Natural History Museum Rotterdamlocation not on record	29
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	26
Stockholm, SE	13
European Distributed Institute of Taxonomy (EDIT)location not on record	11
Philadelphia, US	10
Salzburg, AT	9
South Kensington, GB	8
MZLUlocation not on record	6
Cornell University Insect Collectionlocation not on record	5
Uniwersytet Łódzkilocation not on record	5
Tallinn, EE	4
University of Kaiserslauternlocation not on record	3
Kuopio, FI	3
Zürich, CH	3
ZMAAlocation not on record	2
Trondheim, NO	2
ZSMlocation not on record	2
Rovaniemi, FI	2
DABUHlocation not on record	2
Brussels, BE	1
NTNU-VMlocation not on record	1
Research Collection of Alfred Haslbergerlocation not on record	1
Banyoles, ES	1
Research Collection of Hartmut Wegnerlocation not on record	1
NMBU:MINAlocation not on record	1
BioFokuslocation not on record	1

33 institutions · 1 481 of 1 582 vouchered records shown · 101 without an institution code

09Environmental DNA211 detections

Where the DNA of Agapeta hamana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found211

Studies independent surveys3

Countries16

Verifiable raw sequence linked109

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 211 detections have coordinates

Open the map16 countries0

edge woodland/meadowMediterranean forestflooded meadow, salix treesmeadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 13.2–18.5

Seasonal swing summer↔winter17.5 °C

Max temp (day)19.1 °C 16.6–22.8

Min temp (night)12.6 °C 10.0–15.6

Precipitation66.7 mm/mo 47.3–104

Air humidity60.0 % 57.4–62.2

Moisture balance-55.0 mm/mo -86.1–-13.7

Vapour deficit741 Pa 607–902

Wind speed3.70 m/s 2.70–5.10

Cloud cover41.3 % 33.6–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 208 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agapeta hamana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type39 607 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type39 607 records