Agape chloropyga

(Walker, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agape

At a glance

Occurrence records897

Data sources7

Biological traits0

DNA specimens34

eDNA detections28

Sources7 archives

Databases and archives Agape chloropyga's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility897 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF897 records

Environmental DNA1 datasets · 6 countries28 detections

DNA & barcodingBOLD34 specimens

01Narrative

Agape chloropyga is a species of moth in the family Erebidae. The species is found from Malaysia to eastern Australia, including Borneo and Papua New Guinea. The wingspan is about 60 mm. The larvae feed on the leaves of Moraceae species, including Ficus macrophylla and Ficus microcarpa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agape chloropyga has left across the world's sequence archives.

At a glance

DNA specimens34

BINs6

Marker genes1

eDNA detections28

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

22Avariable

40Amostly conserved

73Amostly conserved

76Avariable

82Tvariable

88Avariable

109Avariable

148Avariable

160Amostly conserved

163Amostly conserved

169Tmostly conserved

187Tmostly conserved

202Cvariable

205Tmostly conserved

217Amostly conserved

220Cvariable

223Avariable

226Tmostly conserved

266Tvariable

287Cvariable

349Tvariable

364Tmostly conserved

367Tmostly conserved

373Avariable

385Tvariable

394Cvariable

397Tvariable

400Cvariable

475Cvariable

484Tmostly conserved

490Tvariable

568Tvariable

586Tmostly conserved

589Tvariable

613Tvariable

616Tmostly conserved

631Amostly conserved

634Tvariable

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCACTTAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes14

BINs6

Most divergent pair4.6%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agape snellenisame genus2.6%Agape arctioidessame genus4.3%Agape stapialissame genus4.7%Asota dianasame family6.8%Metalectra praecisalissame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type897 records

Wild obs. + sensor839

Museum / vouchered58

Range

Area of Occupancy AOO1 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 372≤1 km 166≤10 km 44>10 km 78

660 georeferenced · 179 without coordinates

Open the mapobservation + sensor839

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤1 km 1≤10 km 4

8 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	25
Sydney, AU	4
Natural History Museum of Utahlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
QVMAGlocation not on record	2
Naturalis Biodiversity Centerlocation not on record	1
Research Collection of Graeme V. Cockslocation not on record	1

8 institutions · 39 of 58 vouchered records shown · 19 without an institution code

09Environmental DNA28 detections

Where the DNA of Agape chloropyga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 20.0–26.7

Seasonal swing summer↔winter4.80 °C

Max temp (day)26.7 °C 23.1–29.0

Min temp (night)19.4 °C 15.7–24.6

Precipitation237 mm/mo 25.8–366

Air humidity65.5 % 59.3–70.7

Moisture balance91.3 mm/mo -86.2–229

Vapour deficit1,008 Pa 793–1,163

Wind speed2.00 m/s 1.20–3.50

Cloud cover33.7 % 25.1–68.4

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)