Agamura persica

(Duméril, 1856) · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Gekkonidae/Agamura

At a glance

Occurrence records217

Data sources7

Biological traits2

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Agamura persica's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF217 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

The Persian spider gecko (Agamura persica) hails from semidesert regions of Iran, Pakistan, and Afghanistan, where temperatures range from extreme summer day highs to extreme winter night lows.Szczerbak, N.N. & Golubev, M.L. (1986). Gecko Fauna of the USSR and Contiguous Regions. Kyiv: Naukova Dumka.Anderson, Steven C. (1999). The Lizards of Iran. Ithaca, New York: Society for the Study of Amphibians and Reptiles.Meyer, Michael (2004). Agamura persica - der Spinnengecko aus dem Mittleren Osten. Draco, 18(5), 59-63. Its long, slender legs and tail give it a spider-like impression and allow it to climb in its rocky habitat. The toes are slender, clawed, and angularly bent. It shares this feature with a number of other species and is classified as an angular-toed gecko. Two other species, Agamura femoralis (Smith, 1933) and Agamura misonnei (De Witte, 1973), have been placed in the genus, but Anderson (1999) and Khan (2003) referred them to the genus Rhinogekko.Bauer, A. M., et al. (2013). A preliminary phylogeny of the Palearctic naked-toed geckos (Reptilia: Squamata: Gekkonidae) with taxonomic implications. Zootaxa 3599(4), 301-24.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDB

Size & morphology2

Body mass3.2 g

SVL6 cm

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agamura persica has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P630 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 92 variable positions, in barcode order

6Cmostly conserved

9Amostly conserved

21Cmostly conserved

24Tmostly conserved

30Amostly conserved

31Cmostly conserved

33Amostly conserved

36Tmostly conserved

39Amostly conserved

60Tmostly conserved

63Gmostly conserved

69Gmostly conserved

72Gvariable

81Amostly conserved

93Tmostly conserved

96Cmostly conserved

99Gmostly conserved

105Amostly conserved

108Tmostly conserved

111Amostly conserved

117Gmostly conserved

123Cmostly conserved

135Amostly conserved

141Cmostly conserved

153Cmostly conserved

168Gmostly conserved

169Tmostly conserved

171Gmostly conserved

189Gmostly conserved

198Tmostly conserved

201Amostly conserved

207Cmostly conserved

210Avariable

219Cmostly conserved

234Amostly conserved

256Cmostly conserved

258Amostly conserved

262Cmostly conserved

264Amostly conserved

273Gmostly conserved

276Avariable

279Tmostly conserved

282Gmostly conserved

285Gmostly conserved

291Cmostly conserved

294Gmostly conserved

312Cmostly conserved

315Amostly conserved

318Amostly conserved

327Cmostly conserved

333Amostly conserved

339Tmostly conserved

345Cvariable

363Cmostly conserved

369Cmostly conserved

379Cmostly conserved

381Avariable

384Cvariable

387Gmostly conserved

390Amostly conserved

405Gvariable

420Cmostly conserved

426Gmostly conserved

429Cmostly conserved

447Cmostly conserved

450Gmostly conserved

456Amostly conserved

459Gmostly conserved

462Tmostly conserved

471Amostly conserved

474Amostly conserved

477Cmostly conserved

480Amostly conserved

483Amostly conserved

486Gmostly conserved

490Tmostly conserved

498Amostly conserved

501Cmostly conserved

504Cmostly conserved

505Tmostly conserved

516Gmostly conserved

520Cmostly conserved

522Gmostly conserved

549Gmostly conserved

570Cmostly conserved

594Amostly conserved

597Tmostly conserved

600Tmostly conserved

609Gmostly conserved

615Gmostly conserved

621Gvariable

625Cmostly conserved

GCCGGCATAACCGGCACCGCCCTTAGCCTACTAATTCGAGCCGAACTCAGCCAGCCCGGTGCGCTCCTGGGGGACGACCAAATCTATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes5

BINs3

Most divergent pair11.7%

AsiaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~38.5 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin38.5 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type217 records

Wild obs. + sensor22

Museum / vouchered77

Other118

Range

Area of Occupancy AOO376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 7≤1 km 7≤10 km 4>10 km 1

19 georeferenced · 3 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 6≤1 km 5≤10 km 50>10 km 3

64 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	47
Berkeley, US	13
Washington, US	8
Società romana di Scienze naturalilocation not on record	4
RBINS-Scientific Heritagelocation not on record	2
Brussels, BE	2
Ann Arbor, US	1

7 institutions · 77 of 77 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Agamura persica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 16.9–29.2

Seasonal swing summer↔winter25.5 °C

Max temp (day)29.8 °C 22.2–36.2

Min temp (night)15.4 °C 10.0–20.7

Precipitation7.30 mm/mo 3.10–20.0

Air humidity36.7 % 33.4–41.3

Moisture balance-176 mm/mo -209–-131

Vapour deficit1,892 Pa 1,209–2,655

Wind speed3.70 m/s 2.80–4.40

Cloud cover24.5 % 20.1–26.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)