Agalmatium bilobum

(Fieber, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Issidae/Agalmatium

At a glance

Occurrence records381

Data sources5

Biological traits0

DNA specimens9

eDNA detections17

Sources5 archives

Databases and archives Agalmatium bilobum's data was compiled from.

GBIFGlobal Biodiversity Information Facility381 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF381 records

Environmental DNA1 datasets · 5 countries17 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agalmatium bilobum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections17

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BINs2

Most divergent pair2.9%

Where individuals differ — all 22 variable positions, in barcode order

1Amostly conserved

2Cmostly conserved

21Amostly conserved

39Avariable

99Gmostly conserved

156Tmostly conserved

171Cmostly conserved

189Tmostly conserved

201Cvariable

216Amostly conserved

246Tmostly conserved

375Avariable

432Amostly conserved

441Tmostly conserved

456Cmostly conserved

465Amostly conserved

471Tvariable

522Tmostly conserved

537Cmostly conserved

576Gmostly conserved

582Amostly conserved

615Tvariable

ACTTTATATTTCATCATCGGAATTTGATCCGGATTAGTAGGAATAATAATAAGAATAATTATCCGAATAGAATTATCACAACCAGGATCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agalmatium flavescenssame genus8.2%Hysteropterum reticulatumsame family12.2%Mycterodus ovifronssame family14.1%Mycterodus immaculatussame family14.8%Tshurtshurnella konstantosame family14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type381 records

Wild obs. + sensor209

Museum / vouchered172

Range

Area of Occupancy AOO720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 70≤1 km 36≤10 km 42>10 km 7

155 georeferenced · 54 without coordinates

Open the mapobservation + sensor209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 27≤1 km 5>10 km 7

39 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Natural History Museum, Rangoonlocation not on record	132
Essig Museum of Entomologylocation not on record	12

2 institutions · 144 of 172 vouchered records shown · 28 without an institution code

09Environmental DNA17 detections

Where the DNA of Agalmatium bilobum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map5 countries0

Dry calcareous grassalnds3. Shrubland|3.8. Shrubland - Mediterranean-…85southwestern slope of the gully "Pivnichna C…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 12.6–25.2

Seasonal swing summer↔winter17.2 °C

Max temp (day)26.4 °C 17.0–33.0

Min temp (night)14.9 °C 9.70–18.2

Precipitation28.4 mm/mo 4.40–68.7

Air humidity52.2 % 43.9–56.5

Moisture balance-141 mm/mo -193–-52.5

Vapour deficit1,257 Pa 722–1,781

Wind speed3.00 m/s 2.80–3.80

Cloud cover40.3 % 29.4–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)