Agallia consobrina

Curtis, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Agallia

At a glance

Occurrence records1 576

Data sources7

Biological traits2

DNA specimens20

eDNA detections68

Sources7 archives

Databases and archives Agallia consobrina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI68 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 576 records

Environmental DNA3 datasets · 6 countries68 detections

DNA & barcodingBOLD20 specimens

01Narrative

Die Hain-Dickkopfzikade (Agallia consobrina) ist eine Zwergzikade aus der Unterfamilie der Dickkopfzikaden (Agalliinae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agallia consobrina has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections68

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

40Amostly conserved

73Amostly conserved

88Cmostly conserved

208Tmostly conserved

223Gmostly conserved

238Gmostly conserved

259Cmostly conserved

322Cmostly conserved

337Amostly conserved

373Amostly conserved

380Gmostly conserved

430Gmostly conserved

433Amostly conserved

634Tmostly conserved

CACGATATACTTTATCTTTGGAATATGAGCAGGTATAGTAGGCATAATACTTAGAATGATTATCCGAATTGAACTAGGTCAACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes7

BIN1

Most divergent pair1.2%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Draeculacephala clypeatasame family16.8%Draeculacephala crassicornissame family17.9%Draeculacephala ballisame family17.9%Draeculacephala anguliferasame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 576 records

Wild obs. + sensor1 475

Museum / vouchered101

Range

Area of Occupancy AOO3 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 421≤1 km 144≤10 km 542>10 km 14

1 121 georeferenced · 354 without coordinates

Open the mapobservation + sensor1 475

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 9≤1 km 52≤10 km 37

98 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	66
CBDClocation not on record	13
Museo universitario di Scienze della Terra di Romalocation not on record	1
Paris, FR	1

4 institutions · 81 of 101 vouchered records shown · 20 without an institution code

09Environmental DNA68 detections

Where the DNA of Agallia consobrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found68

Studies independent surveys3

Countries6

Verifiable raw sequence linked44

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 68 detections have coordinates

Open the map6 countries0

Urban area14. Artificial - Terrestrial | 14.2 Pasturel…Urban pine forestCity parks and large gardens

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 13.8–17.4

Seasonal swing summer↔winter16.9 °C

Max temp (day)18.4 °C 15.0–21.5

Min temp (night)15.0 °C 12.0–15.9

Precipitation55.2 mm/mo 42.2–69.7

Air humidity61.9 % 56.5–62.9

Moisture balance-70.1 mm/mo -87.0–-36.6

Vapour deficit728 Pa 591–839

Wind speed5.10 m/s 3.00–5.50

Cloud cover42.9 % 33.9–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 64 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agallia consobrina

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 576 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 576 records