Agabiformius lentus

(Budde-Lund, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Porcellionidae/Agabiformius

At a glance

Occurrence records469

Data sources6

Biological traits0

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Agabiformius lentus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility469 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF469 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Agabiformius lentus is een pissebed uit de familie Porcellionidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1885 door Gustav Budde-Lund.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agabiformius lentus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

82Cvariable

85Gmostly conserved

241Avariable

271Cvariable

284Cmostly conserved

424Avariable

529Tmostly conserved

550Gmostly conserved

622Gvariable

AACATTGTATTTTATTTTTGGGGCTTGAGCAGGGGCTGTAGGAACAGCTCTAAGAATACTTATTCGTATTGAGTTAGGACACCCGGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes3

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hemilepistus elongatussame order15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type469 records

Wild obs. + sensor440

Museum / vouchered29

Range

Area of Occupancy AOO1 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 267≤1 km 44≤10 km 34>10 km 48

393 georeferenced · 47 without coordinates

Open the mapobservation + sensor440

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	8
Stockholm, SE	7
Museum für Naturkunde Berlin (Zoological Collections)location not on record	3
Frankfurt am Main	3
Helsinki, FI	2
Research Center in Biodiversity and Genetic Resourceslocation not on record	1
South Kensington, GB	1
Brussels, BE	1
	1

9 institutions · 27 of 29 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Agabiformius lentus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

3. Shrubland|3.5. Subtropical/Tropical Dry S…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 11.4–27.9

Seasonal swing summer↔winter16.0 °C

Max temp (day)21.3 °C 15.7–31.1

Min temp (night)13.7 °C 7.10–24.0

Precipitation89.7 mm/mo 34.2–175

Air humidity57.8 % 55.8–62.2

Moisture balance-7.70 mm/mo -130–49.5

Vapour deficit895 Pa 539–1,605

Wind speed3.20 m/s 2.10–3.60

Cloud cover35.7 % 22.4–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)