Afrolittorina knysnaensis

(R.A.Philippi, 1847) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Littorinidae/Afrolittorina

At a glance

Occurrence records449

Data sources7

Biological traits0

DNA specimens99

eDNA detections99

Sources7 archives

Databases and archives Afrolittorina knysnaensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

OBISOcean Biodiversity Information System164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics99 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS449 records

Environmental DNA1 datasets · 2 countries99 detections

DNA & barcodingBOLD99 specimens

01Narrative

Afrolittorina knysnaensis is een slakkensoort uit de familie van de Littorinidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1847 door Krauss in Philippi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding99 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Afrolittorina knysnaensis has left across the world's sequence archives.

At a glance

DNA specimens99

BINs1

Marker genes2

eDNA detections99

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P504 bp consensus98 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

2Gmostly conserved

3Cmostly conserved

GGCGCTTTACTGGGAGACGATCAATTATATAATGTAATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTCTAGTTATACCTATAATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes8

BIN1

Most divergent pair0.40%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Afrolittorina africanasame genus9.5%Littorina saxatilissame family13.7%Echinolittorina malaccanasame family15.1%Colus gracilissame order15.5%Ficus variegatasame order15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type449 records

Wild obs. + sensor370

Museum / vouchered54

Other25

Range

Area of Occupancy AOO660 km²

Depth

0–200 m sunlit10

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 10.5 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 117≤1 km 27≤10 km 2>10 km 1

147 georeferenced · 223 without coordinates

Open the mapobservation + sensor370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 1≤1 km 2≤10 km 6>10 km 11

20 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	13
Cambridge, US	6
Ann Arbor, US	4
Denver, US	3
Santa Barbara Museum of Natural Historylocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Brussels, BE	2
Champaign, US	1

8 institutions · 33 of 54 vouchered records shown · 1 without an institution code

09Environmental DNA99 detections

Where the DNA of Afrolittorina knysnaensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map2 countries0

rocky shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 14.2–18.5

Seasonal swing summer↔winter5.50 °C

Max temp (day)20.6 °C 16.8–20.8

Min temp (night)13.8 °C 11.3–16.7

Precipitation66.2 mm/mo 1.60–93.7

Air humidity61.8 % 59.3–63.6

Moisture balance-28.8 mm/mo

Vapour deficit703 Pa 641–810

Wind speed4.60 m/s

Cloud cover15.4 % 10.3–25.4

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)