Afroceto martini

(Simon, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Trachelidae/Afroceto

At a glance

Occurrence records6

Data sources7

Biological traits28

DNA specimens18

eDNA detections15

Sources7 archives

Databases and archives Afroceto martini's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

World Spider Trait DBMasaryk University28 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources28 traits

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD18 specimens

01Narrative

Afroceto martini est une espèce d'araignées aranéomorphes de la famille des Trachelidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLyle & Haddad 2010

Morphometry28

Abdomen length♀2.4·♂1.68 mm

Body length♀4.8·♂3.52 mm

Cephalothorax length♀2.4·♂1.84 mm

Cephalothorax width♀2.05·♂1.65 mm

Femur I length♀2.3·♂3.2 mm

Femur II length♀2.25·♂2.9 mm

Femur III length♀1.73·♂2.2 mm

Femur IV length♀2.3·♂0.8 mm

Leg I length♀8.09·♂16.13 mm

Leg II length♀7.6·♂10.78 mm

Leg III length♀5.96·♂7.9 mm

Leg IV length♀8·♂9.23 mm

Metatarsus I length♀1.73·♂2.45 mm

Metatarsus II length♀1.65·♂2.45 mm

Metatarsus III length♀1.55·♂2.1 mm

Metatarsus IV length♀1.6·♂3.4 mm

Patella I length♀1·♂6.1 mm

Patella II length♀1·♂1.38 mm

Patella III length♀0.8·♂1.1 mm

Patella IV length♀1.05·♂1.25 mm

Tarsus I length♀1.18·♂1.63 mm

Tarsus II length♀1·♂1.55 mm

Tarsus III length♀0.65·♂0.9 mm

Tarsus IV length♀0.85·♂1.18 mm

Tibia I length♀1.88·♂2.75 mm

Tibia II length♀1.7·♂2.5 mm

Tibia III length♀1.23·♂1.6 mm

Tibia IV length♀2.2·♂2.6 mm

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Afroceto martini has left across the world's sequence archives.

At a glance

DNA specimens18

BINs4

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

25Gmostly conserved

31Gvariable

40Gvariable

67Avariable

85Tvariable

91Gvariable

97Gvariable

103Cvariable

163Amostly conserved

178Avariable

193Amostly conserved

208Gvariable

214Amostly conserved

232Tmostly conserved

238Avariable

241Gvariable

259Amostly conserved

268Tmostly conserved

284Tvariable

286Avariable

310Amostly conserved

319Avariable

325Gvariable

334Tmostly conserved

340Cmostly conserved

343Gvariable

355Avariable

356Amostly conserved

361Amostly conserved

400Amostly conserved

406Amostly conserved

412Avariable

427Avariable

439Tvariable

460Cvariable

463Gvariable

475Avariable

484Gmostly conserved

511Tmostly conserved

538Amostly conserved

541Gvariable

547Gmostly conserved

559Gvariable

562Tmostly conserved

577Gmostly conserved

580Amostly conserved

613Tmostly conserved

625Avariable

640Gmostly conserved

643Tmostly conserved

TTTATATTTAATTTTTGGATCTTGGTCTGCGATAGTAGGGACAGCTATAAGAGTAATAATTCGTATAGAATTAGGTCAATCTGGTAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes11

BINs4

Most divergent pair6.1%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Afroceto planasame genus3.2%Patelloceto secutorsame family8.9%Trachelopachys sericeussame family9.5%Trachelopachys cingulipessame family10.3%Thysanina transversasame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor1

Museum / vouchered5

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Museum for Central Africalocation not on record	4
Buenos Aires, AR	1

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Afroceto martini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

4. Native Grassland | 4.6. Subtropical/Tropi…4. Native Grassland | 4.5. Subtropical/Tropi…4. Native Grassland|4.6. Subtropical/Tropica…Deciduous broadleaf woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 17.2–25.2

Seasonal swing summer↔winter10.8 °C

Max temp (day)26.8 °C 23.3–30.0

Min temp (night)15.2 °C 11.0–20.6

Precipitation102 mm/mo 91.6–111

Air humidity56.8 % 52.1–59.8

Moisture balance-50.8 mm/mo -78.1–-35.8

Vapour deficit1,149 Pa 931–1,321

Wind speed2.90 m/s 1.90–3.60

Cloud cover31.5 % 22.8–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)