Afrixalus aureus

Pickersgill, 1984 · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Hyperoliidae/Afrixalus

At a glance

Occurrence records249

Data sources8

Biological traits6

DNA specimens20

eDNA detections18

Sources8 archives

Databases and archives Afrixalus aureus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility249 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF249 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD20 specimens

01Narrative

The golden banana frog, golden dwarf reed frog, golden spiny reed frog, or golden leaf-folding frog (Afrixalus aureus) is a species of frog in the family Hyperoliidae. It is found in lowland coastal plains of eastern South Africa (Mpumalanga and northern KwaZulu-Natal), Eswatini, and southern Mozambique. The AmphibiaWeb includes Afrixalus crotalus in this species as a subspecies, whereas the Amphibian Species of the World and the IUCN Red List of Threatened Species treat A. crotalus as a full species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology1

SVL2.6 cm

Life cycle & reproduction1

Reproductive output1 /year

Habitat & environment3

Habitat aquaticyes

Habitat arborealyes

Habitat terrestrialyes

Other traits1

Repro larvalyes

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Afrixalus aureus has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes2

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 3 variable positions, in barcode order

52Avariable

508Gmostly conserved

655Amostly conserved

AACCCTTTATTTAATCTTTGGGGCTTGAGCCGGAATAGTCGGAACCGGACTAAGCCTCCTTATTCGAGCCGAACTTGCCCAACCAGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Afrixalus delicatussame genus13.0%Afrixalus fornasinisame genus13.8%Afrixalus dorsalissame genus15.9%Hyperolius tuberilinguissame family17.5%Poyntonophrynus fenoulhetisame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type249 records

Wild obs. + sensor71

Museum / vouchered178

Origin

Native69

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 34≤1 km 10≤10 km 2>10 km 1

47 georeferenced · 24 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 177 without coordinates

Open the institutions mapphysical evidence178

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	66
Teylers Museumlocation not on record	55
North-West University, African Amphibian Conservation Research Grouplocation not on record	13
Washington, US	4
CASlocation not on record	2
KwaZulu-Natal Museumlocation not on record	2
Cambridge, US	1

7 institutions · 143 of 178 vouchered records shown · 35 without an institution code

09Environmental DNA18 detections

Where the DNA of Afrixalus aureus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 23.2–25.4

Seasonal swing summer↔winter7.80 °C

Max temp (day)30.0 °C 27.9–30.0

Min temp (night)20.6 °C 18.5–20.8

Precipitation102 mm/mo 86.7–102

Air humidity59.8 % 59.4–60.4

Moisture balance-59.1 mm/mo -60.4–-47.8

Vapour deficit1,295 Pa 1,154–1,295

Wind speed2.90 m/s 2.90–3.50

Cloud cover38.2 % 30.5–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)