Aframomum daniellii

(Hook.f.) K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Aframomum

At a glance

Occurrence records274

Data sources11

Biological traits17

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Aframomum daniellii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS84 compounds

Occurrence & distributionGBIF274 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Aframomum daniellii, also known as African cardamom, is a species in the ginger family, Zingiberaceae. It was first described by Joseph Dalton Hooker, and got its current name from Karl Moritz Schumann.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max4 m

Life cycle & reproduction5

Flowering endMar

Flowering startFeb

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits3

Fruiting endvariable

Fruiting startvariable

Plant support typefree-standing

03Chemical composition84 compounds

Compounds documented for Aframomum daniellii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple phenolic acids7

Carbazole alkaloids6

Cinnamic acids and derivatives5

Simple coumarins5

Quinoline alkaloids5

Documented compounds84 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Evofolin B	present	NPASS
(1R,2R,7S,10S,12R,13S,14R,16S,19S,20S)-19-(Furan-3-yl)-12-hydroxy-9,9,13,20-tetramethyl-4,8,15,18-tetraoxahexacyclo[11.9.0.02,7.02,10.014,16.014,20]docosane-5,11,17-trione	present	NPASS
(2Z)-2-[2-[(1R,2S,8As)-5,5,8a-trimethylspiro[3,4,4a,6,7,8-hexahydro-1H-naphthalene-2,2'-oxirane]-1-yl]ethylidene]butanedial	present	LOTUS
(4aS,8aS,9aR)-9a-hydroxy-3-methyl-5-methylidene-4a,6,7,8,8a,9-hexahydro-4H-benzo[f][1]benzofuran-2-one	present	NPASS
(E)-2-methyl-N-[2-(16-oxo-18-thia-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1(20),3,5,7,9(21),10,12,14(19)-octaen-20-yl)ethyl]but-2-enamide	present	NPASS
(E)-2-methyl-N-[2-(4-thia-6,9,19-triazapentacyclo[10.7.1.03,7.08,20.013,18]icosa-1,3(7),5,8,10,12(20),13,15,17-nonaen-2-yl)ethyl]but-2-enamide	present	NPASS
(E)-8beta,17-Epoxylabd-12-ene-15,16-dial	present	LOTUS
(E)-N-(13-hydroxy-8,15-diazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-1(18),2,4,6,9,11(19),12,14,16-nonaen-9-yl)-2-methylbut-2-enamide	present	NPASS
(S)-evofolin-A	present	NPASS
2-[2-(5,5,8a-trimethylspiro[3,4,4a,6,7,8-hexahydro-1H-naphthalene-2,2'-oxirane]-1-yl)ethylidene]butanedial	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aframomum daniellii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSKU215148.1 ↗569 bp

ACGT

TTGAGAGAGCATTGAATGATGGATGGTTGTGAATGTGTCAACGTGCCCTTCCTTGCCCCATGTTGGTGGGCAATTGACCGTAGCTCGGTG …

Aframomum daniellii voucher 20030092-77 (BR) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type274 records

Wild obs. + sensor19

Museum / vouchered251

Cultivated / captive4

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4>10 km 2

6 georeferenced · 13 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence251

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	31
Saint Louis, US	27
Kew, GB	26
Yaoundé, CM	20
Edinburgh, GB	20
Brussels, BE	12
WAGlocation not on record	9
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	7
Bronx, US	4
Plocation not on record	4
Elocation not on record	3
Coimbra, PT	3
Université du Lomélocation not on record	3
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	3
National Herbarium of São Tomé and Principelocation not on record	3
BRLUlocation not on record	3
LBVlocation not on record	2
Frankfurt am Main	2
South Kensington, GB	2
Uppsala, SE	2
Herbier National du Gabonlocation not on record	2
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	2
MAlocation not on record	2
PRlocation not on record	1
CMULlocation not on record	1
IPHAMETRAlocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Institute for Agricultural Research of Mozambiquelocation not on record	1
CNF-UFHBlocation not on record	1
Paris, FR	1
Dresden, DE	1
Pretoria, ZA	1

32 institutions · 201 of 251 vouchered records shown · 50 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Aframomum daniellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)