Aframomum angustifolium

(Sonn.) K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Aframomum

At a glance

Occurrence records401

Data sources11

Biological traits16

DNA specimens4

eDNA detections3

Sources11 archives

Databases and archives Aframomum angustifolium's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility401 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS24 compounds

Occurrence & distributionGBIF401 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Aframomum angustifolium, known as "wild cardamom" in English, is a species in the ginger family Zingiberaceae that grows in Madagascar, where it is known as longoza. It is herbaceous and like other plants of this family, its erect "stems" consist of layered tubular leaf bases. The species name, angustifolium, means "narrow-leaved" in Latin. The fruit is a berry containing many seeds surrounded by sugary-sweet and sour edible pulp. The crushed seeds are also used as a peppery spice.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height2.46 m

Plant height min1.5 m

Seed mass22.59 mg

Life cycle & reproduction4

Dispersal typeanimal

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition24 compounds

Compounds documented for Aframomum angustifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acyclic monoterpenoids5

Pinane monoterpenoids3

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Bisabolane sesquiterpenoids2

Monocyclic monoterpenoids2

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-trans-Pinocarveol	present	LOTUS
(R)-beta-bisabolene	present	LOTUS
(S)-[6]-Gingerol	present	LOTUS
1-Isopropyl-4-methylbenzene	present	LOTUS
4(10)-Thujene	present	LOTUS
7-Methyl-3-methylene-1,6-octadiene	present	LOTUS
alpha Thujene	present	LOTUS
alpha-Santalene	present	LOTUS
alpha-Terpineol	present	LOTUS
Beta-Bisabolene	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aframomum angustifolium has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ848620.1 ↗591 bp

ACGT

CATTGTTGAGAGAGCATTGAATGATGGATGGTTGTGAATGTGTCAACGTGCCCTTTCCTTGCCCCATGTTGGTGGGCAATTGACCGTAGC …

Aframomum angustifolium isolate EDNA0800366 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL2★ITS4★ITS2

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type401 records

Wild obs. + sensor71

Museum / vouchered327

Other3

Range

Area of Occupancy AOO948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 16≤1 km 5≤10 km 9>10 km 4

34 georeferenced · 37 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 4≤1 km 1≤10 km 19>10 km 8

32 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence327

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	97
Kew, GB	64
Saint Louis, US	31
Plocation not on record	10
LSF/FSA/UAClocation not on record	9
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	8
Instituto de Investigação Científica Tropicallocation not on record	8
Edinburgh, GB	7
Glocation not on record	5
Dresden, DE	4
TAFORI-LSRClocation not on record	3
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	3
South Kensington, GB	3
Moscow State Universitylocation not on record	2
CJBGlocation not on record	2
Université du Lomélocation not on record	2
Paris, FR	2
HNBlocation not on record	2
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	2
Xiamen, CN	1
Uppsala, SE	1
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	1
National Institute of Hygienic Scienceslocation not on record	1
WAGlocation not on record	1
Honolulu, US	1
Bronx, US	1

26 institutions · 271 of 327 vouchered records shown · 56 without an institution code

09Environmental DNA3 detections

Where the DNA of Aframomum angustifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)