Aframomum alboviolaceum

(Ridl.) K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Aframomum

At a glance

Occurrence records749

Data sources13

Biological traits16

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Aframomum alboviolaceum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility749 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF749 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Aframomum alboviolaceum is a monocotyledonous plant species that was first described by Henry Nicholas Ridley, and got its current name from Karl Moritz Schumann. Aframomum alboviolaceum is part of the genus Aframomum and the family Zingiberaceae. No subspecies are listed in the Catalog of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height2 m

Plant height max3.05 m

Plant height min1.52 m

Seed mass32.88 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition17 compounds

Compounds documented for Aframomum alboviolaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Catechols with side chains4

Labdane diterpenoids3

Lupane triterpenoids2

Norlabdane diterpenoids1

Taraxerane triterpenoids1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Galanolactone	present	LOTUS
(18alpha,19alpha)-5alpha-Urs-20(30)-en-3-one	present	NPASS
(4aS,6aS,7S,11aR,11bS)-1,2,3,4,4a,5,6,7,8,11,11a,11b-Dodecahydro-7-hydroxy-4,4,11b-trimethyl-6aH-cyclohepta(a)naphthalene-6a,9-dicarboxaldehyde	present	LOTUS
[(3aR,4S,9R,9aS,9bR)-9-(hydroxymethyl)-6-methyl-3-methylidene-2,7-dioxo-4,5,8,9,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 2-(4-hydroxyphenyl)acetate	present	NPASS
Aframodial	present	LOTUS
beta-Sitosterol	present	NPASS
Cichoriol A	present	NPASS
Cichoriol B	present	NPASS
Cichoriol C	present	NPASS
Cichoriol D	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aframomum alboviolaceum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMW905290.1 ↗571 bp

ACGT

CATTGTTGAGAGAGCATTGAATGATGGATGGTTGTGAATGTGTCAACGTGCCCTTTCCTTGCCCCATGTTGGTGGGCAATTGACCGTAGC …

Aframomum alboviolaceum isolate Z236 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aframomum alboviolaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · book-ipcn65 · CCDB · book-fedorov

CCDB · book-ipcn65 — Mangenot & M. 1962

CCDB · book-fedorov — Mangenot S., Mangenot G. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type749 records

Wild obs. + sensor493

Museum / vouchered249

Other7

Range

Area of Occupancy AOO1 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 40≤1 km 2≤10 km 1

43 georeferenced · 450 without coordinates

Open the mapobservation + sensor493

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 1≤10 km 1>10 km 3

9 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence249

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	75
Kew, GB	30
Saint Louis, US	19
LBVlocation not on record	11
Yaoundé, CM	8
Edinburgh, GB	8
Dresden, DE	8
BRLUlocation not on record	7
WAGlocation not on record	6
South Kensington, GB	5
HNBlocation not on record	4
MAlocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	4
Herbier National du Gabonlocation not on record	3
PRlocation not on record	3
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
Wlocation not on record	2
LSFlocation not on record	1
Beijing, CN	1
Elocation not on record	1
National Natural History Collectionslocation not on record	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
TAFORI-LSRClocation not on record	1
CNF-UFHBlocation not on record	1
University of Santo Tomas Museumlocation not on record	1
Centre National des Semences Forestièreslocation not on record	1
Université du Lomélocation not on record	1
Uppsala, SE	1
Plocation not on record	1

30 institutions · 212 of 249 vouchered records shown · 37 without an institution code

09Environmental DNA1 detections

Where the DNA of Aframomum alboviolaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)