Afgekia sericea

Craib · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Afgekia

At a glance

Occurrence records30

Data sources8

Biological traits6

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Afgekia sericea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

أفجكية حريرية هي نوع من النباتات يتبع جنس الأفجكية من الفصيلة البقولية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formliana

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Afgekia sericea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSMK953948.1 ↗573 bp

ACGT

CGATGCCCCGCGAGAAAATCCGACCCGTGGACCTGTTCGGGCGCTGCTCTAAGGCCGGGAGGGGCGCTGCCAGGCGCTCCCCTCCCGGCC …

Afgekia sericea internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Afgekia sericea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — J. Compton,B. Schrire,Klmn Knyves3,F. Forest,P. Malakasi,Sawai Mattapha and Y. Sirichamorn. 2019. "The Callerya Group redefined and Tribe Wisterieae (Fabaceae) emended based on morphology and data from nuclear and chloroplast DNA sequences". PhytoKeys 125:1-112.

08Occurrence & distribution

Record type30 records

Wild obs. + sensor5

Museum / vouchered25

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 1>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	8
Saint Louis, US	2
Bronx, US	1
Edinburgh, GB	1
South Kensington, GB	1

5 institutions · 13 of 25 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Afgekia sericea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)