Aetomylaeus vespertilio

(Bleeker, 1852) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Myliobatidae/Aetomylaeus

At a glance

Occurrence records126

Data sources9

Biological traits7

DNA specimens9

eDNA detections10

Sources9 archives

Databases and archives Aetomylaeus vespertilio's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

OBISOcean Biodiversity Information System38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS126 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

The ornate eagle ray or reticulate eagle ray (Aetomylaeus vespertilio) is a species of large stingray of the family Myliobatidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length240 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max110 m

Depth min1 m

Vulnerability82.5

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetomylaeus vespertilio has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

9Amostly conserved

39Cvariable

116Tvariable

177Avariable

240Amostly conserved

324Gvariable

444Cvariable

454Gmostly conserved

561Tmostly conserved

615Cmostly conserved

624Gvariable

CTCTACTTAATTTTTGGTGCATGAGCAGGGATAGTGGGCACTGGTCTCAGTTTACTTATCCGAACAGAATTAAGTCAGCCCGGGGCCCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes5

BIN1

Most divergent pair1.2%

AsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Myliobatis tenuicaudatussame family15.8%Megatrygon micropssame order16.2%Gymnura natalensissame order16.4%Gymnura seretisame order16.4%Myliobatis longirostrissame family16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type126 records

Wild obs. + sensor89

Museum / vouchered35

Cultivated / captive2

Range

Area of Occupancy AOO272 km²

Depth

0–200 m sunlit13

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17 m · max 150 m · 13 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 15≤1 km 20≤10 km 5>10 km 32

72 georeferenced · 17 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 6≤1 km 13≤10 km 3

22 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence35

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	8
Curtin Universitylocation not on record	2
FishBaselocation not on record	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
DEWlocation not on record	1
Sydney, AU	1

6 institutions · 14 of 35 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Aetomylaeus vespertilio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.6–26.8

Seasonal swing summer↔winter11.9 °C

Max temp (day)29.6 °C 26.6–30.5

Min temp (night)20.0 °C 19.3–25.1

Precipitation109 mm/mo 76.2–459

Air humidity55.5 % 52.0–68.2

Moisture balance105 mm/mo

Vapour deficit1,471 Pa 1,070–1,616

Wind speed2.00 m/s

Cloud cover25.2 % 21.4–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)