Aethomys hindei

(Thomas, 1902) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Muridae/Aethomys

At a glance

Occurrence records324

Data sources8

Biological traits18

DNA specimens34

eDNA detections2

Sources8 archives

Databases and archives Aethomys hindei's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility324 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF324 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD34 specimens

01Narrative

Hinde's rock rat (Aethomys hindei) is a species of rodent in the family Muridae found in Burundi, Cameroon, the Central African Republic, the Democratic Republic of the Congo, Ethiopia, Kenya, Rwanda, Sudan, Tanzania, and Uganda. Its natural habitats are subtropical or tropical moist lowland forest, moist savanna, and subtropical or tropical seasonally wet or flooded lowland grassland. Oldfield Thomas named it in honor of Sidney Langford Hinde, a British officer and recreational naturalist.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology2

Body mass141 g

⚠ sources differ — PanTHERIA: 141 g · AmnioteDB: 98.5 g · EltonTraits: 104 g

SVL16.28 cm

Life cycle & reproduction6

Age at sexual maturity59.11 days

⚠ sources differ — PanTHERIA: 59.11 days · AmnioteDB: 96.05 days

Gestation24.66 days

Litter size2.05

⚠ sources differ — PanTHERIA: 2.05 · AmnioteDB: 2.9

Max. longevity32.9 months

Neonate mass5.27 g

Weaning age26.24 days

Diet & foraging3

Fruit20 %

Plant other60 %

Seed20 %

Habitat & environment1

Terrestriality-999.00

Physiology & chemistry2

Precipitation mean101 mm

Temperature mean242 decidegC

Other traits4

Activity cycle-999.00

Foraging stratumG

Home range0.001 km²

Population density2 191 /km²

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethomys hindei has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

81Amostly conserved

105Tmostly conserved

279Cmostly conserved

294Amostly conserved

339Tmostly conserved

354Tmostly conserved

426Cmostly conserved

450Gmostly conserved

639Cmostly conserved

ACTCTATACCTACTATTCGGTGCTTGAGCAGGAATAGTAGGAACAGCCCTAAGCATCCTAATTCGAGCAGAACTAGGACAACCAGGCGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes4

BIN1

Most divergent pair2.4%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Grammomys dolichurussame family12.5%Aethomys chrysophilussame genus12.8%Aethomys ineptussame genus12.8%Lemniscomys rosaliasame family12.9%Colomys goslingisame family13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type324 records

Wild obs. + sensor3

Museum / vouchered321

Origin

Native18

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 19≤1 km 9≤10 km 11>10 km 1

40 georeferenced · 281 without coordinates

Open the institutions mapphysical evidence321

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	108
Royal Museum for Central Africalocation not on record	80
Paris, FR	38
Bonn, DE	35
	18
Berkeley, US	11
Toronto, CA	10
South Kensington, GB	9
Brussels, BE	4
New Haven, US	3
RBINS-Scientific Heritagelocation not on record	2
Seattle, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Washington, US	1

14 institutions · 321 of 321 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aethomys hindei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 19.6–19.6

Seasonal swing summer↔winter2.60 °C

Max temp (day)25.2 °C

Min temp (night)13.2 °C

Precipitation23.9 mm/mo

Air humidity54.9 %

Moisture balance-122 mm/mo

Vapour deficit1,027 Pa

Wind speed3.40 m/s

Cloud cover21.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)