Aetholix flavibasalis

(Guenée, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Aetholix

At a glance

Occurrence records223

Data sources7

Biological traits0

DNA specimens20

eDNA detections22

Sources7 archives

Databases and archives Aetholix flavibasalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF223 records

Environmental DNA1 datasets · 7 countries22 detections

DNA & barcodingBOLD20 specimens

01Narrative

Aetholix flavibasalis is a moth in the family Crambidae. It was described by Achille Guenée in 1854. It is found in Australia (Queensland), Thailand, western India, Sri Lanka, the Andamans and on Borneo. The forewings are brown with a pale spot. There is a white band across the hindwings. Both wings have a cream and orange thorax and basal area. The larvae feed on Garcinia mangostana and Eugenia species.Lepidoptera Larvae of Australia

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetholix flavibasalis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections22

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

1Avariable

37Amostly conserved

103Tmostly conserved

106Tmostly conserved

166Avariable

189Gmostly conserved

220Avariable

229Amostly conserved

235Cmostly conserved

271Tmostly conserved

364Tmostly conserved

391Tmostly conserved

401Tmostly conserved

478Amostly conserved

508Amostly conserved

517Tmostly conserved

557Cvariable

562Amostly conserved

595Tmostly conserved

596Tmostly conserved

601Tmostly conserved

616Tvariable

631Avariable

646Tmostly conserved

AACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes8

BIN1

Most divergent pair2.1%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Patania deficienssame family6.2%Agrotera scissalissame family6.4%Crocidolomia pavonanasame family6.5%Agrotera citrinasame family6.5%Cnaphalocrocis cochrusalissame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type223 records

Wild obs. + sensor215

Museum / vouchered8

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 62≤1 km 83≤10 km 17>10 km 11

173 georeferenced · 42 without coordinates

Open the mapobservation + sensor215

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	1
Australian National Insect Collectionlocation not on record	1

2 institutions · 2 of 8 vouchered records shown · 6 without an institution code

09Environmental DNA22 detections

Where the DNA of Aetholix flavibasalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 22.8–26.7

Seasonal swing summer↔winter1.90 °C

Max temp (day)28.7 °C 25.2–29.5

Min temp (night)22.5 °C 20.0–25.6

Precipitation263 mm/mo 86.2–441

Air humidity68.2 % 62.6–72.5

Moisture balance243 mm/mo

Vapour deficit1,008 Pa 747–1,317

Wind speed1.70 m/s

Cloud cover56.4 % 29.9–69.4

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)